Incidental Mutation 'R8501:Idh2'
ID655321
Institutional Source Beutler Lab
Gene Symbol Idh2
Ensembl Gene ENSMUSG00000030541
Gene Nameisocitrate dehydrogenase 2 (NADP+), mitochondrial
SynonymsIdh-2, IDPm
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8501 (G1)
Quality Score217.468
Status Not validated
Chromosome7
Chromosomal Location80094846-80115392 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) TCCCAGG to T at 80098331 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107384] [ENSMUST00000125542] [ENSMUST00000134328] [ENSMUST00000164056] [ENSMUST00000206714]
Predicted Effect probably benign
Transcript: ENSMUST00000107384
SMART Domains Protein: ENSMUSP00000103007
Gene: ENSMUSG00000030541

DomainStartEndE-ValueType
Iso_dh 49 441 5.32e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134070
Predicted Effect probably benign
Transcript: ENSMUST00000134328
SMART Domains Protein: ENSMUSP00000118184
Gene: ENSMUSG00000030541

DomainStartEndE-ValueType
Iso_dh 49 284 1.59e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156761
Predicted Effect probably benign
Transcript: ENSMUST00000164056
SMART Domains Protein: ENSMUSP00000132361
Gene: ENSMUSG00000048897

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
low complexity region 106 127 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
ZnF_C2H2 297 319 2.71e-2 SMART
ZnF_C2H2 325 347 1.92e-2 SMART
ZnF_C2H2 353 375 2.71e-2 SMART
ZnF_C2H2 381 403 1.18e-2 SMART
ZnF_C2H2 409 431 1.67e-2 SMART
ZnF_C2H2 437 459 4.87e-4 SMART
ZnF_C2H2 465 487 3.83e-2 SMART
ZnF_C2H2 493 515 2.12e-4 SMART
ZnF_C2H2 521 543 3.63e-3 SMART
ZnF_C2H2 549 571 1.58e-3 SMART
ZnF_C2H2 577 600 3.69e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206714
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the mitochondria. It plays a role in intermediary metabolism and energy production. This protein may tightly associate or interact with the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit suppression of tumorigenesis from B16F10 melanoma cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
5031439G07Rik C T 15: 84,960,523 V98M probably damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Atg2a T C 19: 6,254,390 S1146P probably damaging Het
Atg3 C A 16: 45,182,931 D207E probably damaging Het
Atp8b3 A G 10: 80,520,146 V1244A probably benign Het
Cacna1i T C 15: 80,382,046 probably null Het
Ccdc171 G T 4: 83,663,658 E675* probably null Het
Cep68 A T 11: 20,239,132 S627T unknown Het
Chrnd T C 1: 87,192,616 W165R probably damaging Het
Col6a2 G T 10: 76,603,557 A791D probably damaging Het
Dlg2 C A 7: 92,375,722 S598R probably damaging Het
Elfn2 G T 15: 78,674,300 Q16K probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Grm8 A T 6: 27,618,541 M434K probably damaging Het
Igf2 G C 7: 142,654,042 P106R probably damaging Het
Klf7 T C 1: 64,079,163 S92G probably benign Het
Mme T A 3: 63,326,735 M73K probably damaging Het
Musk G C 4: 58,367,502 K588N probably damaging Het
Naa30 C A 14: 49,172,896 H94N possibly damaging Het
Naip6 C T 13: 100,300,276 A580T possibly damaging Het
Nfya A G 17: 48,398,989 L52P unknown Het
Olfr126 A G 17: 37,850,865 Y91C probably damaging Het
Olfr346 A G 2: 36,688,797 N265S probably benign Het
Olfr65 T A 7: 103,906,611 H54Q Het
Otogl A T 10: 107,790,560 M1481K probably benign Het
P4ha3 A G 7: 100,313,355 D440G probably damaging Het
Pcdhb13 A T 18: 37,444,440 T624S probably damaging Het
Piezo2 A G 18: 63,045,540 Y1769H probably damaging Het
Plekha6 T A 1: 133,287,837 V913E probably benign Het
Rapgefl1 A G 11: 98,842,227 E211G possibly damaging Het
Rcc2 T C 4: 140,715,926 L305P probably damaging Het
Rgs3 G T 4: 62,602,956 V47F possibly damaging Het
Scly A G 1: 91,319,076 S370G probably damaging Het
Setmar T A 6: 108,075,861 D105E probably benign Het
Slc9a9 A G 9: 94,855,739 Y233C probably damaging Het
Sp140 A T 1: 85,641,740 N357I probably damaging Het
Trim30c G C 7: 104,387,470 T227R probably benign Het
Unc79 G A 12: 103,092,638 V1014I probably damaging Het
Vmn1r151 A T 7: 22,499,609 F24I probably damaging Het
Vmn2r78 T C 7: 86,920,886 V204A probably damaging Het
Vps13a T C 19: 16,682,120 D1681G probably benign Het
Vwa2 T C 19: 56,908,982 V573A probably benign Het
Wfdc2 A G 2: 164,563,359 D44G probably damaging Het
Zfp40 T A 17: 23,178,298 N75I probably damaging Het
Other mutations in Idh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Idh2 APN 7 80097945 missense probably benign
IGL02281:Idh2 APN 7 80095802 splice site probably null
IGL02874:Idh2 APN 7 80097873 missense probably damaging 1.00
IGL02892:Idh2 APN 7 80095670 missense probably benign
IGL02937:Idh2 APN 7 80098913 missense probably damaging 1.00
IGL02989:Idh2 APN 7 80099108 missense probably damaging 1.00
R0040:Idh2 UTSW 7 80097822 missense probably damaging 1.00
R0040:Idh2 UTSW 7 80097822 missense probably damaging 1.00
R0090:Idh2 UTSW 7 80097914 missense probably damaging 1.00
R0322:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0384:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0385:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0386:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0387:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0494:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R1603:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1681:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1711:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1844:Idh2 UTSW 7 80098877 missense probably benign 0.31
R3700:Idh2 UTSW 7 80099147 missense probably damaging 1.00
R4941:Idh2 UTSW 7 80096099 missense probably damaging 0.98
R5234:Idh2 UTSW 7 80096105 missense probably damaging 0.99
R5387:Idh2 UTSW 7 80098331 intron probably benign
R5582:Idh2 UTSW 7 80098339 frame shift probably null
R5655:Idh2 UTSW 7 80098248 missense probably damaging 0.99
R6191:Idh2 UTSW 7 80098331 intron probably benign
R6261:Idh2 UTSW 7 80098329 intron probably benign
R6311:Idh2 UTSW 7 80098331 intron probably benign
R6351:Idh2 UTSW 7 80098331 intron probably benign
R6413:Idh2 UTSW 7 80098331 intron probably benign
R6561:Idh2 UTSW 7 80098331 intron probably benign
R6709:Idh2 UTSW 7 80098331 intron probably benign
R6772:Idh2 UTSW 7 80098331 intron probably benign
R6781:Idh2 UTSW 7 80098331 intron probably benign
R6848:Idh2 UTSW 7 80098331 intron probably benign
R6861:Idh2 UTSW 7 80098218 missense probably damaging 1.00
R6899:Idh2 UTSW 7 80098331 intron probably benign
R7063:Idh2 UTSW 7 80095684 missense probably damaging 1.00
R7076:Idh2 UTSW 7 80098331 intron probably benign
R7081:Idh2 UTSW 7 80098329 intron probably benign
R7090:Idh2 UTSW 7 80098331 intron probably benign
R7254:Idh2 UTSW 7 80098331 frame shift probably null
R7298:Idh2 UTSW 7 80098331 intron probably benign
R7401:Idh2 UTSW 7 80098329 intron probably benign
R7560:Idh2 UTSW 7 80098331 frame shift probably null
R7561:Idh2 UTSW 7 80098331 intron probably benign
R7694:Idh2 UTSW 7 80098331 intron probably benign
R7816:Idh2 UTSW 7 80098331 intron probably benign
R7884:Idh2 UTSW 7 80098329 intron probably benign
R7919:Idh2 UTSW 7 80098331 intron probably benign
R7961:Idh2 UTSW 7 80098253 missense probably benign 0.18
R8009:Idh2 UTSW 7 80098253 missense probably benign 0.18
R8036:Idh2 UTSW 7 80098331 intron probably benign
R8162:Idh2 UTSW 7 80098329 intron probably benign
R8321:Idh2 UTSW 7 80098331 intron probably benign
R8451:Idh2 UTSW 7 80098331 intron probably benign
R8488:Idh2 UTSW 7 80098329 intron probably benign
RF030:Idh2 UTSW 7 80098329 intron probably benign
Predicted Primers PCR Primer
(F):5'- GGAAGCATCAGAGGTTGTTACTTG -3'
(R):5'- GCTTAAACAAGCCTGTACCAGC -3'

Sequencing Primer
(F):5'- GTCAAAGATCTCCTGGAAGATGTC -3'
(R):5'- GCCTGTACCAGCTATAAGGTCTAG -3'
Posted On2020-10-20