Incidental Mutation 'R8501:P4ha3'
ID 655324
Institutional Source Beutler Lab
Gene Symbol P4ha3
Ensembl Gene ENSMUSG00000051048
Gene Name procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R8501 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 100285520-100319699 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100313355 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 440 (D440G)
Ref Sequence ENSEMBL: ENSMUSP00000055297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057023] [ENSMUST00000139790]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000057023
AA Change: D440G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055297
Gene: ENSMUSG00000051048
AA Change: D440G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:P4Ha_N 31 159 1.4e-31 PFAM
SCOP:d1ihga1 177 258 8e-4 SMART
P4Hc 344 526 1.08e-50 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000119159
Gene: ENSMUSG00000051048
AA Change: D306G

DomainStartEndE-ValueType
PDB:4BTB|A 1 141 7e-17 PDB
SCOP:d1ihga1 44 125 4e-4 SMART
P4Hc 211 372 4.89e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139790
SMART Domains Protein: ENSMUSP00000117015
Gene: ENSMUSG00000051048

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
5031439G07Rik C T 15: 84,960,523 V98M probably damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Atg2a T C 19: 6,254,390 S1146P probably damaging Het
Atg3 C A 16: 45,182,931 D207E probably damaging Het
Atp8b3 A G 10: 80,520,146 V1244A probably benign Het
Cacna1i T C 15: 80,382,046 probably null Het
Ccdc171 G T 4: 83,663,658 E675* probably null Het
Cep68 A T 11: 20,239,132 S627T unknown Het
Chrnd T C 1: 87,192,616 W165R probably damaging Het
Col6a2 G T 10: 76,603,557 A791D probably damaging Het
Dlg2 C A 7: 92,375,722 S598R probably damaging Het
Elfn2 G T 15: 78,674,300 Q16K probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Grm8 A T 6: 27,618,541 M434K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf2 G C 7: 142,654,042 P106R probably damaging Het
Klf7 T C 1: 64,079,163 S92G probably benign Het
Mme T A 3: 63,326,735 M73K probably damaging Het
Musk G C 4: 58,367,502 K588N probably damaging Het
Naa30 C A 14: 49,172,896 H94N possibly damaging Het
Naip6 C T 13: 100,300,276 A580T possibly damaging Het
Nfya A G 17: 48,398,989 L52P unknown Het
Olfr126 A G 17: 37,850,865 Y91C probably damaging Het
Olfr346 A G 2: 36,688,797 N265S probably benign Het
Olfr65 T A 7: 103,906,611 H54Q Het
Otogl A T 10: 107,790,560 M1481K probably benign Het
Pcdhb13 A T 18: 37,444,440 T624S probably damaging Het
Piezo2 A G 18: 63,045,540 Y1769H probably damaging Het
Plekha6 T A 1: 133,287,837 V913E probably benign Het
Rapgefl1 A G 11: 98,842,227 E211G possibly damaging Het
Rcc2 T C 4: 140,715,926 L305P probably damaging Het
Rgs3 G T 4: 62,602,956 V47F possibly damaging Het
Scly A G 1: 91,319,076 S370G probably damaging Het
Setmar T A 6: 108,075,861 D105E probably benign Het
Slc9a9 A G 9: 94,855,739 Y233C probably damaging Het
Sp140 A T 1: 85,641,740 N357I probably damaging Het
Trim30c G C 7: 104,387,470 T227R probably benign Het
Unc79 G A 12: 103,092,638 V1014I probably damaging Het
Vmn1r151 A T 7: 22,499,609 F24I probably damaging Het
Vmn2r78 T C 7: 86,920,886 V204A probably damaging Het
Vps13a T C 19: 16,682,120 D1681G probably benign Het
Vwa2 T C 19: 56,908,982 V573A probably benign Het
Wfdc2 A G 2: 164,563,359 D44G probably damaging Het
Zfp40 T A 17: 23,178,298 N75I probably damaging Het
Other mutations in P4ha3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:P4ha3 APN 7 100305933 missense probably damaging 1.00
IGL01875:P4ha3 APN 7 100300652 missense probably damaging 0.97
IGL02265:P4ha3 APN 7 100293932 missense probably benign
IGL02957:P4ha3 APN 7 100318905 splice site probably benign
IGL03279:P4ha3 APN 7 100300686 missense probably damaging 1.00
R0006:P4ha3 UTSW 7 100318948 nonsense probably null
R0880:P4ha3 UTSW 7 100305909 missense probably benign 0.06
R1066:P4ha3 UTSW 7 100318063 missense possibly damaging 0.77
R1118:P4ha3 UTSW 7 100313328 missense probably damaging 0.99
R1119:P4ha3 UTSW 7 100313328 missense probably damaging 0.99
R1236:P4ha3 UTSW 7 100293849 missense probably damaging 1.00
R1613:P4ha3 UTSW 7 100313250 missense possibly damaging 0.95
R1778:P4ha3 UTSW 7 100300691 splice site probably null
R2042:P4ha3 UTSW 7 100300690 critical splice donor site probably null
R3437:P4ha3 UTSW 7 100285624 missense possibly damaging 0.93
R4393:P4ha3 UTSW 7 100305607 missense probably benign 0.06
R5411:P4ha3 UTSW 7 100293815 missense probably damaging 1.00
R5722:P4ha3 UTSW 7 100305991 missense probably benign 0.03
R6209:P4ha3 UTSW 7 100317085 missense probably benign 0.09
R6462:P4ha3 UTSW 7 100314666 missense probably damaging 1.00
R6606:P4ha3 UTSW 7 100305644 missense probably damaging 0.99
R7578:P4ha3 UTSW 7 100293914 missense probably benign 0.02
R7769:P4ha3 UTSW 7 100285717 missense probably damaging 0.97
R8031:P4ha3 UTSW 7 100292698 missense probably damaging 1.00
R8090:P4ha3 UTSW 7 100300652 missense probably damaging 0.97
R8296:P4ha3 UTSW 7 100317102 missense probably damaging 1.00
R8379:P4ha3 UTSW 7 100293779 missense probably damaging 0.99
R8516:P4ha3 UTSW 7 100314662 missense probably damaging 0.97
R8692:P4ha3 UTSW 7 100306021 missense probably damaging 0.99
RF033:P4ha3 UTSW 7 100310810 frame shift probably null
Z1177:P4ha3 UTSW 7 100293788 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGCAGTACTTCCAACATCAGATC -3'
(R):5'- ACTCGCAAATTCTGGAGAAGAG -3'

Sequencing Primer
(F):5'- GTACTTCCAACATCAGATCACTTATG -3'
(R):5'- TAAGAAACTGAATCCAAGAATCAGTG -3'
Posted On 2020-10-20