Incidental Mutation 'R8501:Gm40460'
ID655327
Institutional Source Beutler Lab
Gene Symbol Gm40460
Ensembl Gene ENSMUSG00000110324
Gene Namepredicted gene, 40460
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R8501 (G1)
Quality Score106.461
Status Not validated
Chromosome7
Chromosomal Location142240344-142241078 bp(-) (GRCm38)
Type of Mutationsmall deletion (10 aa in frame mutation)
DNA Base Change (assembly) ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG at 142240713 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147331 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000211591
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
5031439G07Rik C T 15: 84,960,523 V98M probably damaging Het
Agbl2 G A 2: 90,797,564 G238R probably damaging Het
Atg2a T C 19: 6,254,390 S1146P probably damaging Het
Atg3 C A 16: 45,182,931 D207E probably damaging Het
Atp8b3 A G 10: 80,520,146 V1244A probably benign Het
Cacna1i T C 15: 80,382,046 probably null Het
Ccdc171 G T 4: 83,663,658 E675* probably null Het
Cep68 A T 11: 20,239,132 S627T unknown Het
Chrnd T C 1: 87,192,616 W165R probably damaging Het
Col6a2 G T 10: 76,603,557 A791D probably damaging Het
Dlg2 C A 7: 92,375,722 S598R probably damaging Het
Elfn2 G T 15: 78,674,300 Q16K probably benign Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Grm8 A T 6: 27,618,541 M434K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf2 G C 7: 142,654,042 P106R probably damaging Het
Klf7 T C 1: 64,079,163 S92G probably benign Het
Mme T A 3: 63,326,735 M73K probably damaging Het
Musk G C 4: 58,367,502 K588N probably damaging Het
Naa30 C A 14: 49,172,896 H94N possibly damaging Het
Naip6 C T 13: 100,300,276 A580T possibly damaging Het
Nfya A G 17: 48,398,989 L52P unknown Het
Olfr126 A G 17: 37,850,865 Y91C probably damaging Het
Olfr346 A G 2: 36,688,797 N265S probably benign Het
Olfr65 T A 7: 103,906,611 H54Q Het
Otogl A T 10: 107,790,560 M1481K probably benign Het
P4ha3 A G 7: 100,313,355 D440G probably damaging Het
Pcdhb13 A T 18: 37,444,440 T624S probably damaging Het
Piezo2 A G 18: 63,045,540 Y1769H probably damaging Het
Plekha6 T A 1: 133,287,837 V913E probably benign Het
Rapgefl1 A G 11: 98,842,227 E211G possibly damaging Het
Rcc2 T C 4: 140,715,926 L305P probably damaging Het
Rgs3 G T 4: 62,602,956 V47F possibly damaging Het
Scly A G 1: 91,319,076 S370G probably damaging Het
Setmar T A 6: 108,075,861 D105E probably benign Het
Slc9a9 A G 9: 94,855,739 Y233C probably damaging Het
Sp140 A T 1: 85,641,740 N357I probably damaging Het
Trim30c G C 7: 104,387,470 T227R probably benign Het
Unc79 G A 12: 103,092,638 V1014I probably damaging Het
Vmn1r151 A T 7: 22,499,609 F24I probably damaging Het
Vmn2r78 T C 7: 86,920,886 V204A probably damaging Het
Vps13a T C 19: 16,682,120 D1681G probably benign Het
Vwa2 T C 19: 56,908,982 V573A probably benign Het
Wfdc2 A G 2: 164,563,359 D44G probably damaging Het
Zfp40 T A 17: 23,178,298 N75I probably damaging Het
Other mutations in Gm40460
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6822:Gm40460 UTSW 7 142240713 small deletion probably benign
R7016:Gm40460 UTSW 7 142240817 small deletion probably benign
R7053:Gm40460 UTSW 7 142240817 small deletion probably benign
R7083:Gm40460 UTSW 7 142240713 small deletion probably benign
R7087:Gm40460 UTSW 7 142240434 small deletion probably benign
R7110:Gm40460 UTSW 7 142240817 small deletion probably benign
R7184:Gm40460 UTSW 7 142240713 small deletion probably benign
R7224:Gm40460 UTSW 7 142240434 small deletion probably benign
R7367:Gm40460 UTSW 7 142240434 small deletion probably benign
R7411:Gm40460 UTSW 7 142240817 small deletion probably benign
R7481:Gm40460 UTSW 7 142240817 small deletion probably benign
R7491:Gm40460 UTSW 7 142240713 small deletion probably benign
R7553:Gm40460 UTSW 7 142240713 small deletion probably benign
R7637:Gm40460 UTSW 7 142240713 small deletion probably benign
R7643:Gm40460 UTSW 7 142240713 small deletion probably benign
R7663:Gm40460 UTSW 7 142240713 small deletion probably benign
R7785:Gm40460 UTSW 7 142240434 small deletion probably benign
R7871:Gm40460 UTSW 7 142240817 small deletion probably benign
R7895:Gm40460 UTSW 7 142240713 small deletion probably benign
R8054:Gm40460 UTSW 7 142240817 small deletion probably benign
R8355:Gm40460 UTSW 7 142240817 small deletion probably benign
R8389:Gm40460 UTSW 7 142240434 small deletion probably benign
R8509:Gm40460 UTSW 7 142240817 small deletion probably benign
RF040:Gm40460 UTSW 7 142240817 small deletion probably benign
Z1177:Gm40460 UTSW 7 142240772 missense unknown
Z1177:Gm40460 UTSW 7 142240906 missense unknown
Predicted Primers PCR Primer
(F):5'- GAACCTCAGATCTTGCACTGG -3'
(R):5'- AAGGGAGGCTGTAGTTCCTG -3'

Sequencing Primer
(F):5'- AGCAGCAGGGCTTACAGC -3'
(R):5'- TCCTGTGGGGGCTGCAAG -3'
Posted On2020-10-20