Incidental Mutation 'R8503:Cntnap2'
ID 655411
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms 5430425M22Rik, Caspr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8503 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 45059357-47304213 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45992041 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 239 (E239G)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000114641
AA Change: E239G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: E239G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Arsk A T 13: 76,091,711 Y124* probably null Het
Atm A G 9: 53,488,052 Y1550H probably damaging Het
Atp10b A G 11: 43,222,239 T871A possibly damaging Het
BC051142 T C 17: 34,448,126 probably benign Het
Birc6 T A 17: 74,692,244 Y4656N probably damaging Het
Bpifa3 C A 2: 154,130,630 A32D probably damaging Het
Casp12 T C 9: 5,346,739 probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cped1 C T 6: 22,145,565 L641F probably benign Het
Cr2 G A 1: 195,163,542 P35L probably benign Het
Cyp4f15 T A 17: 32,695,364 C211S probably damaging Het
Defa29 T A 8: 21,325,887 probably benign Het
Eif2b5 T C 16: 20,498,980 S23P probably benign Het
Fam151a T C 4: 106,746,180 F313L possibly damaging Het
Fggy T A 4: 95,902,058 probably benign Het
Gldc C T 19: 30,099,854 V973I probably benign Het
Glipr1l2 A C 10: 112,107,170 E310A probably benign Het
Gpr85 G A 6: 13,836,830 T25I probably benign Het
Grin2a T A 16: 9,663,549 I463F probably damaging Het
Hoxd10 T C 2: 74,692,380 L134P probably benign Het
Kif3b T G 2: 153,320,904 probably null Het
Klra17 T C 6: 129,868,814 I146V probably benign Het
Lhpp A G 7: 132,705,677 T268A probably benign Het
Mab21l1 G T 3: 55,783,183 E64* probably null Het
Nipal3 C T 4: 135,479,581 A101T probably damaging Het
Nlgn1 A T 3: 26,133,373 I121N probably damaging Het
Nuggc G A 14: 65,641,348 probably null Het
Obscn T C 11: 59,000,617 M7030V unknown Het
Olfr1112 T A 2: 87,192,309 Y207* probably null Het
Olfr1511 A G 14: 52,389,897 I292T probably damaging Het
Olfr801 T C 10: 129,669,643 N292S probably damaging Het
Otogl A G 10: 107,892,126 C245R probably damaging Het
Papolg C T 11: 23,870,292 V433I probably benign Het
Pcdh12 A G 18: 38,282,521 V517A possibly damaging Het
Pds5b A G 5: 150,716,507 E29G possibly damaging Het
Phlpp1 T C 1: 106,392,289 I1338T probably benign Het
Pom121 T A 5: 135,381,544 S920C unknown Het
Prdm16 A G 4: 154,341,552 V592A probably benign Het
R3hdm2 T A 10: 127,492,612 N734K possibly damaging Het
Rpa2 G C 4: 132,773,869 V126L probably benign Het
Sash1 A T 10: 8,780,513 probably benign Het
Shmt2 C T 10: 127,518,920 V299I probably benign Het
Sp3 T A 2: 72,938,301 Q706L probably benign Het
Sycp2l A C 13: 41,153,476 D125A Het
Tmem169 A G 1: 72,301,007 T199A probably damaging Het
Tnip1 A G 11: 54,936,465 M157T probably benign Het
Tubb3 A G 8: 123,421,029 S234G probably damaging Het
Ubtd2 A G 11: 32,499,267 K38R possibly damaging Het
Unc13a A C 8: 71,645,761 F1127V possibly damaging Het
Wdpcp G A 11: 21,721,205 W482* probably null Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 46015263 missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46988787 missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47193038 missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46484072 missense probably benign
IGL00857:Cntnap2 APN 6 47049424 missense probably benign 0.00
IGL01290:Cntnap2 APN 6 46015465 missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47193013 missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47271371 nonsense probably null
IGL01859:Cntnap2 APN 6 46988721 missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46234203 missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 47021654 missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46234320 missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 47021736 missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47095549 missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46170245 missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46530171 missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46483983 missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45060392 splice site probably null
R0352:Cntnap2 UTSW 6 45992084 splice site probably null
R0389:Cntnap2 UTSW 6 46009637 missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45715816 missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46529905 nonsense probably null
R0611:Cntnap2 UTSW 6 47095549 missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46988760 missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47296708 splice site probably benign
R0976:Cntnap2 UTSW 6 47271230 missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1387:Cntnap2 UTSW 6 47107914 missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46530679 missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 46015330 missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47107892 nonsense probably null
R1757:Cntnap2 UTSW 6 46759829 missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46988675 missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46530633 missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47298588 missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47298445 missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 46015266 missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45991903 missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46856128 missense probably benign
R4030:Cntnap2 UTSW 6 46856128 missense probably benign
R4237:Cntnap2 UTSW 6 46530390 intron probably benign
R4445:Cntnap2 UTSW 6 46759851 missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46530035 intron probably benign
R4918:Cntnap2 UTSW 6 46530035 intron probably benign
R4999:Cntnap2 UTSW 6 45920834 missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45920926 nonsense probably null
R5748:Cntnap2 UTSW 6 45715884 missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46529815 intron probably benign
R6118:Cntnap2 UTSW 6 47193077 missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46759808 missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47271298 missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45060112 splice site probably null
R6385:Cntnap2 UTSW 6 46856180 missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46759760 missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46170272 missense probably benign 0.25
R6610:Cntnap2 UTSW 6 46015257 missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46988646 missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47271271 missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46484029 missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46347145 missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47095693 missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R8479:Cntnap2 UTSW 6 46759773 missense probably benign 0.14
R8698:Cntnap2 UTSW 6 47049222 missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 46001227 missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46856142 missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46484049 missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46484205 intron probably benign
R9209:Cntnap2 UTSW 6 47049249 missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 46001178 missense probably benign 0.00
R9310:Cntnap2 UTSW 6 46001347 missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 46001310 missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46234283 missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 46015231 missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45992075 missense probably damaging 0.98
R9621:Cntnap2 UTSW 6 46988792 missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 46015439 frame shift probably null
R9745:Cntnap2 UTSW 6 46234166 missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47049327 missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 47021665 missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 46009518 missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 47021754 missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46234245 missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47271148 missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 46015299 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCTCAGGGGCTGACGTTATC -3'
(R):5'- CGATAGCAGCTTTTCTCTGTTAAGAAG -3'

Sequencing Primer
(F):5'- ATCAACTTTGATGGCCACGG -3'
(R):5'- ACATGTCTGCTGGTCATAAAGGTCAG -3'
Posted On 2020-10-20