Incidental Mutation 'R8503:Glipr1l2'
ID655418
Institutional Source Beutler Lab
Gene Symbol Glipr1l2
Ensembl Gene ENSMUSG00000020214
Gene NameGLI pathogenesis-related 1 like 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R8503 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location112083354-112108098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 112107170 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 310 (E310A)
Ref Sequence ENSEMBL: ENSMUSP00000020434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020434] [ENSMUST00000148897]
Predicted Effect probably benign
Transcript: ENSMUST00000020434
AA Change: E310A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000020434
Gene: ENSMUSG00000020214
AA Change: E310A

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
SCP 49 199 7.3e-30 SMART
transmembrane domain 251 273 N/A INTRINSIC
low complexity region 303 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148897
SMART Domains Protein: ENSMUSP00000122771
Gene: ENSMUSG00000020214

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
SCP 49 199 7.3e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cysteine-rich secretory protein, antigen 5, and pathogenesis-related 1 superfamily. Members of this family have roles in a variety of processes, including cancer and immune defense. This gene is located in a cluster with two related genes on chromosome 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Arsk A T 13: 76,091,711 Y124* probably null Het
Atm A G 9: 53,488,052 Y1550H probably damaging Het
Atp10b A G 11: 43,222,239 T871A possibly damaging Het
Birc6 T A 17: 74,692,244 Y4656N probably damaging Het
Bpifa3 C A 2: 154,130,630 A32D probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cntnap2 A G 6: 45,992,041 E239G probably damaging Het
Cped1 C T 6: 22,145,565 L641F probably benign Het
Cr2 G A 1: 195,163,542 P35L probably benign Het
Cyp4f15 T A 17: 32,695,364 C211S probably damaging Het
Eif2b5 T C 16: 20,498,980 S23P probably benign Het
Fam151a T C 4: 106,746,180 F313L possibly damaging Het
Gldc C T 19: 30,099,854 V973I probably benign Het
Gpr85 G A 6: 13,836,830 T25I probably benign Het
Grin2a T A 16: 9,663,549 I463F probably damaging Het
Hoxd10 T C 2: 74,692,380 L134P probably benign Het
Kif3b T G 2: 153,320,904 probably null Het
Klra17 T C 6: 129,868,814 I146V probably benign Het
Lhpp A G 7: 132,705,677 T268A probably benign Het
Mab21l1 G T 3: 55,783,183 E64* probably null Het
Nipal3 C T 4: 135,479,581 A101T probably damaging Het
Nlgn1 A T 3: 26,133,373 I121N probably damaging Het
Nuggc G A 14: 65,641,348 probably null Het
Obscn T C 11: 59,000,617 M7030V unknown Het
Olfr1112 T A 2: 87,192,309 Y207* probably null Het
Olfr1511 A G 14: 52,389,897 I292T probably damaging Het
Olfr801 T C 10: 129,669,643 N292S probably damaging Het
Otogl A G 10: 107,892,126 C245R probably damaging Het
Papolg C T 11: 23,870,292 V433I probably benign Het
Pcdh12 A G 18: 38,282,521 V517A possibly damaging Het
Pds5b A G 5: 150,716,507 E29G possibly damaging Het
Phlpp1 T C 1: 106,392,289 I1338T probably benign Het
Pom121 T A 5: 135,381,544 S920C unknown Het
Prdm16 A G 4: 154,341,552 V592A probably benign Het
R3hdm2 T A 10: 127,492,612 N734K possibly damaging Het
Rpa2 G C 4: 132,773,869 V126L probably benign Het
Shmt2 C T 10: 127,518,920 V299I probably benign Het
Sp3 T A 2: 72,938,301 Q706L probably benign Het
Sycp2l A C 13: 41,153,476 D125A Het
Tmem169 A G 1: 72,301,007 T199A probably damaging Het
Tnip1 A G 11: 54,936,465 M157T probably benign Het
Tubb3 A G 8: 123,421,029 S234G probably damaging Het
Ubtd2 A G 11: 32,499,267 K38R possibly damaging Het
Unc13a A C 8: 71,645,761 F1127V possibly damaging Het
Wdpcp G A 11: 21,721,205 W482* probably null Het
Other mutations in Glipr1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Glipr1l2 APN 10 112097982 missense probably benign
IGL02236:Glipr1l2 APN 10 112092629 missense probably damaging 1.00
IGL02683:Glipr1l2 APN 10 112083476 missense probably benign
PIT1430001:Glipr1l2 UTSW 10 112106840 missense probably benign 0.02
R0450:Glipr1l2 UTSW 10 112092572 missense probably benign 0.02
R1172:Glipr1l2 UTSW 10 112083466 missense possibly damaging 0.91
R1173:Glipr1l2 UTSW 10 112083466 missense possibly damaging 0.91
R1174:Glipr1l2 UTSW 10 112083466 missense possibly damaging 0.91
R1175:Glipr1l2 UTSW 10 112083466 missense possibly damaging 0.91
R1743:Glipr1l2 UTSW 10 112092565 missense probably benign 0.01
R1918:Glipr1l2 UTSW 10 112092645 nonsense probably null
R4879:Glipr1l2 UTSW 10 112107124 missense probably benign 0.01
R4964:Glipr1l2 UTSW 10 112106999 missense possibly damaging 0.49
R5122:Glipr1l2 UTSW 10 112107056 missense possibly damaging 0.94
R6059:Glipr1l2 UTSW 10 112083518 missense probably benign 0.01
R7102:Glipr1l2 UTSW 10 112092425 critical splice acceptor site probably null
R7593:Glipr1l2 UTSW 10 112092560 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTTCTGGTACCCACCTTGG -3'
(R):5'- GCATTCTACCTTTTAACGTTTTGGG -3'

Sequencing Primer
(F):5'- GCCCAGTCGTGTGTAATCCAATG -3'
(R):5'- GCTTCTATTGAGTTGTCTTC -3'
Posted On2020-10-20