Incidental Mutation 'R8503:Olfr801'
ID655421
Institutional Source Beutler Lab
Gene Symbol Olfr801
Ensembl Gene ENSMUSG00000058513
Gene Nameolfactory receptor 801
SynonymsGA_x6K02T2PULF-11349138-11348182, MOR110-10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8503 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location129666989-129673865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129669643 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 292 (N292S)
Ref Sequence ENSEMBL: ENSMUSP00000148943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072063] [ENSMUST00000203424] [ENSMUST00000213294] [ENSMUST00000216067]
Predicted Effect probably damaging
Transcript: ENSMUST00000072063
AA Change: N292S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071941
Gene: ENSMUSG00000058513
AA Change: N292S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.2e-51 PFAM
Pfam:7tm_1 39 288 8.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203424
SMART Domains Protein: ENSMUSP00000145011
Gene: ENSMUSG00000058513

DomainStartEndE-ValueType
Pfam:7tm_4 1 96 5.9e-18 PFAM
Pfam:7tm_1 2 96 1.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213294
AA Change: N292S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216067
AA Change: N292S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Arsk A T 13: 76,091,711 Y124* probably null Het
Atm A G 9: 53,488,052 Y1550H probably damaging Het
Atp10b A G 11: 43,222,239 T871A possibly damaging Het
Birc6 T A 17: 74,692,244 Y4656N probably damaging Het
Bpifa3 C A 2: 154,130,630 A32D probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cntnap2 A G 6: 45,992,041 E239G probably damaging Het
Cped1 C T 6: 22,145,565 L641F probably benign Het
Cr2 G A 1: 195,163,542 P35L probably benign Het
Cyp4f15 T A 17: 32,695,364 C211S probably damaging Het
Eif2b5 T C 16: 20,498,980 S23P probably benign Het
Fam151a T C 4: 106,746,180 F313L possibly damaging Het
Gldc C T 19: 30,099,854 V973I probably benign Het
Glipr1l2 A C 10: 112,107,170 E310A probably benign Het
Gpr85 G A 6: 13,836,830 T25I probably benign Het
Grin2a T A 16: 9,663,549 I463F probably damaging Het
Hoxd10 T C 2: 74,692,380 L134P probably benign Het
Kif3b T G 2: 153,320,904 probably null Het
Klra17 T C 6: 129,868,814 I146V probably benign Het
Lhpp A G 7: 132,705,677 T268A probably benign Het
Mab21l1 G T 3: 55,783,183 E64* probably null Het
Nipal3 C T 4: 135,479,581 A101T probably damaging Het
Nlgn1 A T 3: 26,133,373 I121N probably damaging Het
Nuggc G A 14: 65,641,348 probably null Het
Obscn T C 11: 59,000,617 M7030V unknown Het
Olfr1112 T A 2: 87,192,309 Y207* probably null Het
Olfr1511 A G 14: 52,389,897 I292T probably damaging Het
Otogl A G 10: 107,892,126 C245R probably damaging Het
Papolg C T 11: 23,870,292 V433I probably benign Het
Pcdh12 A G 18: 38,282,521 V517A possibly damaging Het
Pds5b A G 5: 150,716,507 E29G possibly damaging Het
Phlpp1 T C 1: 106,392,289 I1338T probably benign Het
Pom121 T A 5: 135,381,544 S920C unknown Het
Prdm16 A G 4: 154,341,552 V592A probably benign Het
R3hdm2 T A 10: 127,492,612 N734K possibly damaging Het
Rpa2 G C 4: 132,773,869 V126L probably benign Het
Shmt2 C T 10: 127,518,920 V299I probably benign Het
Sp3 T A 2: 72,938,301 Q706L probably benign Het
Sycp2l A C 13: 41,153,476 D125A Het
Tmem169 A G 1: 72,301,007 T199A probably damaging Het
Tnip1 A G 11: 54,936,465 M157T probably benign Het
Tubb3 A G 8: 123,421,029 S234G probably damaging Het
Ubtd2 A G 11: 32,499,267 K38R possibly damaging Het
Unc13a A C 8: 71,645,761 F1127V possibly damaging Het
Wdpcp G A 11: 21,721,205 W482* probably null Het
Other mutations in Olfr801
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Olfr801 APN 10 129669887 missense probably damaging 1.00
IGL02400:Olfr801 APN 10 129669883 missense probably damaging 0.99
IGL02721:Olfr801 APN 10 129670123 missense probably benign 0.08
IGL03107:Olfr801 APN 10 129669940 missense probably benign 0.00
R0114:Olfr801 UTSW 10 129669598 missense probably benign
R0140:Olfr801 UTSW 10 129669688 missense probably damaging 1.00
R0652:Olfr801 UTSW 10 129670379 missense probably benign 0.08
R1375:Olfr801 UTSW 10 129670372 missense probably null 0.97
R1449:Olfr801 UTSW 10 129670369 missense probably damaging 0.99
R2026:Olfr801 UTSW 10 129670465 missense probably damaging 1.00
R2241:Olfr801 UTSW 10 129669895 missense probably damaging 1.00
R2516:Olfr801 UTSW 10 129670286 missense probably damaging 1.00
R2869:Olfr801 UTSW 10 129669759 nonsense probably null
R2869:Olfr801 UTSW 10 129669759 nonsense probably null
R2870:Olfr801 UTSW 10 129669759 nonsense probably null
R2870:Olfr801 UTSW 10 129669759 nonsense probably null
R2873:Olfr801 UTSW 10 129669759 nonsense probably null
R6562:Olfr801 UTSW 10 129670139 missense probably damaging 1.00
R8362:Olfr801 UTSW 10 129670231 missense possibly damaging 0.88
Z1177:Olfr801 UTSW 10 129669794 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CCAGAAGAGATAATCCTCTCAATGTG -3'
(R):5'- AAAAGGCCTTTTCCACCTGC -3'

Sequencing Primer
(F):5'- CCTCTCAATGTGACTGAAAAACTATC -3'
(R):5'- GCTCCTCACACATGGTTGTTG -3'
Posted On2020-10-20