Incidental Mutation 'R8503:Arsk'
ID655429
Institutional Source Beutler Lab
Gene Symbol Arsk
Ensembl Gene ENSMUSG00000021592
Gene Namearylsulfatase K
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8503 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location76060422-76098660 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 76091711 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 124 (Y124*)
Ref Sequence ENSEMBL: ENSMUSP00000113274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120573] [ENSMUST00000223579]
Predicted Effect probably null
Transcript: ENSMUST00000120573
AA Change: Y124*
SMART Domains Protein: ENSMUSP00000113274
Gene: ENSMUSG00000021592
AA Change: Y124*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Sulfatase 35 371 6e-49 PFAM
low complexity region 381 392 N/A INTRINSIC
low complexity region 537 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223579
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfatases (EC 3.1.5.6), such as ARSK, hydrolyze sulfate esters from sulfated steroids, carbohydrates, proteoglycans, and glycolipids. They are involved in hormone biosynthesis, modulation of cell signaling, and degradation of macromolecules (Sardiello et al., 2005 [PubMed 16174644]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Atm A G 9: 53,488,052 Y1550H probably damaging Het
Atp10b A G 11: 43,222,239 T871A possibly damaging Het
Birc6 T A 17: 74,692,244 Y4656N probably damaging Het
Bpifa3 C A 2: 154,130,630 A32D probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cntnap2 A G 6: 45,992,041 E239G probably damaging Het
Cped1 C T 6: 22,145,565 L641F probably benign Het
Cr2 G A 1: 195,163,542 P35L probably benign Het
Cyp4f15 T A 17: 32,695,364 C211S probably damaging Het
Eif2b5 T C 16: 20,498,980 S23P probably benign Het
Fam151a T C 4: 106,746,180 F313L possibly damaging Het
Gldc C T 19: 30,099,854 V973I probably benign Het
Glipr1l2 A C 10: 112,107,170 E310A probably benign Het
Gpr85 G A 6: 13,836,830 T25I probably benign Het
Grin2a T A 16: 9,663,549 I463F probably damaging Het
Hoxd10 T C 2: 74,692,380 L134P probably benign Het
Kif3b T G 2: 153,320,904 probably null Het
Klra17 T C 6: 129,868,814 I146V probably benign Het
Lhpp A G 7: 132,705,677 T268A probably benign Het
Mab21l1 G T 3: 55,783,183 E64* probably null Het
Nipal3 C T 4: 135,479,581 A101T probably damaging Het
Nlgn1 A T 3: 26,133,373 I121N probably damaging Het
Nuggc G A 14: 65,641,348 probably null Het
Obscn T C 11: 59,000,617 M7030V unknown Het
Olfr1112 T A 2: 87,192,309 Y207* probably null Het
Olfr1511 A G 14: 52,389,897 I292T probably damaging Het
Olfr801 T C 10: 129,669,643 N292S probably damaging Het
Otogl A G 10: 107,892,126 C245R probably damaging Het
Papolg C T 11: 23,870,292 V433I probably benign Het
Pcdh12 A G 18: 38,282,521 V517A possibly damaging Het
Pds5b A G 5: 150,716,507 E29G possibly damaging Het
Phlpp1 T C 1: 106,392,289 I1338T probably benign Het
Pom121 T A 5: 135,381,544 S920C unknown Het
Prdm16 A G 4: 154,341,552 V592A probably benign Het
R3hdm2 T A 10: 127,492,612 N734K possibly damaging Het
Rpa2 G C 4: 132,773,869 V126L probably benign Het
Shmt2 C T 10: 127,518,920 V299I probably benign Het
Sp3 T A 2: 72,938,301 Q706L probably benign Het
Sycp2l A C 13: 41,153,476 D125A Het
Tmem169 A G 1: 72,301,007 T199A probably damaging Het
Tnip1 A G 11: 54,936,465 M157T probably benign Het
Tubb3 A G 8: 123,421,029 S234G probably damaging Het
Ubtd2 A G 11: 32,499,267 K38R possibly damaging Het
Unc13a A C 8: 71,645,761 F1127V possibly damaging Het
Wdpcp G A 11: 21,721,205 W482* probably null Het
Other mutations in Arsk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Arsk APN 13 76098368 splice site probably null
IGL02537:Arsk APN 13 76074906 nonsense probably null
IGL02691:Arsk APN 13 76074950 missense probably damaging 0.98
IGL03038:Arsk APN 13 76065513 splice site probably benign
PIT4480001:Arsk UTSW 13 76062365 missense probably damaging 1.00
R0277:Arsk UTSW 13 76074932 missense probably benign 0.01
R0900:Arsk UTSW 13 76098457 unclassified probably benign
R1441:Arsk UTSW 13 76074964 missense probably benign 0.01
R1748:Arsk UTSW 13 76062410 missense probably benign 0.15
R1923:Arsk UTSW 13 76066866 splice site probably benign
R2131:Arsk UTSW 13 76091812 nonsense probably null
R3723:Arsk UTSW 13 76066653 missense probably damaging 0.98
R4088:Arsk UTSW 13 76098414 missense probably benign
R4851:Arsk UTSW 13 76065279 critical splice donor site probably null
R5406:Arsk UTSW 13 76093947 missense probably benign
R5629:Arsk UTSW 13 76093908 missense probably damaging 1.00
R5869:Arsk UTSW 13 76091784 missense probably benign 0.29
R6217:Arsk UTSW 13 76091816 missense unknown
R6552:Arsk UTSW 13 76072196 missense probably damaging 0.99
R6560:Arsk UTSW 13 76074986 missense probably benign 0.33
R6726:Arsk UTSW 13 76074788 missense probably damaging 1.00
R7421:Arsk UTSW 13 76062515 missense possibly damaging 0.81
R8178:Arsk UTSW 13 76091742 missense probably damaging 1.00
R8274:Arsk UTSW 13 76072184 missense probably damaging 1.00
X0050:Arsk UTSW 13 76065280 missense probably null 0.78
X0066:Arsk UTSW 13 76062456 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCCAGGCTGCTAAAATCCAG -3'
(R):5'- GGCATTTCATATTCCAGACCACAG -3'

Sequencing Primer
(F):5'- GGCTGCTAAAATCCAGTAACTATAC -3'
(R):5'- GCCAGCCATGCTCTCAAG -3'
Posted On2020-10-20