Incidental Mutation 'R8503:Pcdh12'
ID655436
Institutional Source Beutler Lab
Gene Symbol Pcdh12
Ensembl Gene ENSMUSG00000024440
Gene Nameprotocadherin 12
SynonymsVE-cadherin-2, vascular endothelial cadherin-2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8503 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location38267092-38284402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38282521 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 517 (V517A)
Ref Sequence ENSEMBL: ENSMUSP00000025311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025311] [ENSMUST00000194012]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025311
AA Change: V517A

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025311
Gene: ENSMUSG00000024440
AA Change: V517A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
CA 53 133 4.42e-2 SMART
CA 157 242 2.55e-17 SMART
CA 266 350 2.31e-24 SMART
CA 376 458 3.86e-26 SMART
CA 482 563 6.27e-26 SMART
CA 621 704 3.02e-2 SMART
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 960 975 N/A INTRINSIC
low complexity region 1032 1041 N/A INTRINSIC
low complexity region 1115 1125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194012
SMART Domains Protein: ENSMUSP00000141907
Gene: ENSMUSG00000024440

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing 6 cadherin repeats, a transmembrane domain and a cytoplasmic tail that differs from those of the classical cadherins. The gene localizes to the region on chromosome 5 where the protocadherin gene clusters reside. The exon organization of this transcript is similar to that of the gene cluster transcripts, notably the first large exon, but no significant sequence homology exists. The function of this cellular adhesion protein is undetermined but mouse protocadherin 12 does not bind catenins and appears to have no affect on cell migration or growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable, fertile and do not display any obvious histomorphological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Arsk A T 13: 76,091,711 Y124* probably null Het
Atm A G 9: 53,488,052 Y1550H probably damaging Het
Atp10b A G 11: 43,222,239 T871A possibly damaging Het
Birc6 T A 17: 74,692,244 Y4656N probably damaging Het
Bpifa3 C A 2: 154,130,630 A32D probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cntnap2 A G 6: 45,992,041 E239G probably damaging Het
Cped1 C T 6: 22,145,565 L641F probably benign Het
Cr2 G A 1: 195,163,542 P35L probably benign Het
Cyp4f15 T A 17: 32,695,364 C211S probably damaging Het
Eif2b5 T C 16: 20,498,980 S23P probably benign Het
Fam151a T C 4: 106,746,180 F313L possibly damaging Het
Gldc C T 19: 30,099,854 V973I probably benign Het
Glipr1l2 A C 10: 112,107,170 E310A probably benign Het
Gpr85 G A 6: 13,836,830 T25I probably benign Het
Grin2a T A 16: 9,663,549 I463F probably damaging Het
Hoxd10 T C 2: 74,692,380 L134P probably benign Het
Kif3b T G 2: 153,320,904 probably null Het
Klra17 T C 6: 129,868,814 I146V probably benign Het
Lhpp A G 7: 132,705,677 T268A probably benign Het
Mab21l1 G T 3: 55,783,183 E64* probably null Het
Nipal3 C T 4: 135,479,581 A101T probably damaging Het
Nlgn1 A T 3: 26,133,373 I121N probably damaging Het
Nuggc G A 14: 65,641,348 probably null Het
Obscn T C 11: 59,000,617 M7030V unknown Het
Olfr1112 T A 2: 87,192,309 Y207* probably null Het
Olfr1511 A G 14: 52,389,897 I292T probably damaging Het
Olfr801 T C 10: 129,669,643 N292S probably damaging Het
Otogl A G 10: 107,892,126 C245R probably damaging Het
Papolg C T 11: 23,870,292 V433I probably benign Het
Pds5b A G 5: 150,716,507 E29G possibly damaging Het
Phlpp1 T C 1: 106,392,289 I1338T probably benign Het
Pom121 T A 5: 135,381,544 S920C unknown Het
Prdm16 A G 4: 154,341,552 V592A probably benign Het
R3hdm2 T A 10: 127,492,612 N734K possibly damaging Het
Rpa2 G C 4: 132,773,869 V126L probably benign Het
Shmt2 C T 10: 127,518,920 V299I probably benign Het
Sp3 T A 2: 72,938,301 Q706L probably benign Het
Sycp2l A C 13: 41,153,476 D125A Het
Tmem169 A G 1: 72,301,007 T199A probably damaging Het
Tnip1 A G 11: 54,936,465 M157T probably benign Het
Tubb3 A G 8: 123,421,029 S234G probably damaging Het
Ubtd2 A G 11: 32,499,267 K38R possibly damaging Het
Unc13a A C 8: 71,645,761 F1127V possibly damaging Het
Wdpcp G A 11: 21,721,205 W482* probably null Het
Other mutations in Pcdh12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pcdh12 APN 18 38281457 missense probably benign
IGL00964:Pcdh12 APN 18 38282731 missense probably benign 0.27
IGL01105:Pcdh12 APN 18 38275347 missense probably damaging 1.00
IGL02011:Pcdh12 APN 18 38281420 missense probably damaging 1.00
IGL02234:Pcdh12 APN 18 38283535 missense probably damaging 1.00
IGL02452:Pcdh12 APN 18 38281693 missense probably benign 0.00
IGL03412:Pcdh12 APN 18 38283515 missense probably benign 0.24
R0729:Pcdh12 UTSW 18 38282464 missense probably benign 0.20
R1330:Pcdh12 UTSW 18 38281861 missense probably benign 0.13
R1394:Pcdh12 UTSW 18 38281189 critical splice donor site probably null
R1413:Pcdh12 UTSW 18 38283443 missense probably damaging 1.00
R1993:Pcdh12 UTSW 18 38282143 missense possibly damaging 0.62
R2115:Pcdh12 UTSW 18 38283986 missense probably damaging 1.00
R2567:Pcdh12 UTSW 18 38282096 missense probably damaging 1.00
R2926:Pcdh12 UTSW 18 38282390 missense probably damaging 0.99
R3810:Pcdh12 UTSW 18 38281237 missense probably damaging 1.00
R3813:Pcdh12 UTSW 18 38283614 nonsense probably null
R5275:Pcdh12 UTSW 18 38284101 utr 5 prime probably benign
R5400:Pcdh12 UTSW 18 38268898 missense probably damaging 1.00
R5523:Pcdh12 UTSW 18 38283139 missense probably damaging 1.00
R5539:Pcdh12 UTSW 18 38281744 missense possibly damaging 0.77
R5604:Pcdh12 UTSW 18 38268882 missense probably damaging 1.00
R6012:Pcdh12 UTSW 18 38283752 missense probably damaging 1.00
R6042:Pcdh12 UTSW 18 38281505 missense probably damaging 1.00
R6129:Pcdh12 UTSW 18 38277859 missense probably damaging 1.00
R6239:Pcdh12 UTSW 18 38282401 missense probably damaging 1.00
R6508:Pcdh12 UTSW 18 38281337 nonsense probably null
R7250:Pcdh12 UTSW 18 38281976 missense probably benign
R7259:Pcdh12 UTSW 18 38281624 missense probably benign 0.00
R7271:Pcdh12 UTSW 18 38283047 missense probably damaging 1.00
R7489:Pcdh12 UTSW 18 38281789 missense possibly damaging 0.77
R8103:Pcdh12 UTSW 18 38282159 missense probably damaging 1.00
R8157:Pcdh12 UTSW 18 38282797 missense probably benign
R8322:Pcdh12 UTSW 18 38281577 nonsense probably null
R8510:Pcdh12 UTSW 18 38282056 missense possibly damaging 0.89
Z1177:Pcdh12 UTSW 18 38282992 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGAGGCATTTACAAGCACCG -3'
(R):5'- GATGTCAATGACAATGCCCCTG -3'

Sequencing Primer
(F):5'- TCATTGGCATCCAAGAGG -3'
(R):5'- ACAATGCCCCTGTGTTTGAGAAG -3'
Posted On2020-10-20