Incidental Mutation 'R8503:Gldc'
ID655437
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Nameglycine decarboxylase
SynonymsD030049L12Rik, D19Wsu57e
Accession Numbers

Genbank: NM_138595.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8503 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location30098449-30175418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30099854 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 973 (V973I)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
Predicted Effect probably benign
Transcript: ENSMUST00000025778
AA Change: V973I

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: V973I

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Arsk A T 13: 76,091,711 Y124* probably null Het
Atm A G 9: 53,488,052 Y1550H probably damaging Het
Atp10b A G 11: 43,222,239 T871A possibly damaging Het
BC051142 T C 17: 34,448,126 probably benign Het
Birc6 T A 17: 74,692,244 Y4656N probably damaging Het
Bpifa3 C A 2: 154,130,630 A32D probably damaging Het
Casp12 T C 9: 5,346,739 probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cntnap2 A G 6: 45,992,041 E239G probably damaging Het
Cped1 C T 6: 22,145,565 L641F probably benign Het
Cr2 G A 1: 195,163,542 P35L probably benign Het
Cyp4f15 T A 17: 32,695,364 C211S probably damaging Het
Defa29 T A 8: 21,325,887 probably benign Het
Eif2b5 T C 16: 20,498,980 S23P probably benign Het
Fam151a T C 4: 106,746,180 F313L possibly damaging Het
Fggy T A 4: 95,902,058 probably benign Het
Glipr1l2 A C 10: 112,107,170 E310A probably benign Het
Gpr85 G A 6: 13,836,830 T25I probably benign Het
Grin2a T A 16: 9,663,549 I463F probably damaging Het
Hoxd10 T C 2: 74,692,380 L134P probably benign Het
Kif3b T G 2: 153,320,904 probably null Het
Klra17 T C 6: 129,868,814 I146V probably benign Het
Lhpp A G 7: 132,705,677 T268A probably benign Het
Mab21l1 G T 3: 55,783,183 E64* probably null Het
Nipal3 C T 4: 135,479,581 A101T probably damaging Het
Nlgn1 A T 3: 26,133,373 I121N probably damaging Het
Nuggc G A 14: 65,641,348 probably null Het
Obscn T C 11: 59,000,617 M7030V unknown Het
Olfr1112 T A 2: 87,192,309 Y207* probably null Het
Olfr1511 A G 14: 52,389,897 I292T probably damaging Het
Olfr801 T C 10: 129,669,643 N292S probably damaging Het
Otogl A G 10: 107,892,126 C245R probably damaging Het
Papolg C T 11: 23,870,292 V433I probably benign Het
Pcdh12 A G 18: 38,282,521 V517A possibly damaging Het
Pds5b A G 5: 150,716,507 E29G possibly damaging Het
Phlpp1 T C 1: 106,392,289 I1338T probably benign Het
Pom121 T A 5: 135,381,544 S920C unknown Het
Prdm16 A G 4: 154,341,552 V592A probably benign Het
R3hdm2 T A 10: 127,492,612 N734K possibly damaging Het
Rpa2 G C 4: 132,773,869 V126L probably benign Het
Sash1 A T 10: 8,780,513 probably benign Het
Shmt2 C T 10: 127,518,920 V299I probably benign Het
Sp3 T A 2: 72,938,301 Q706L probably benign Het
Sycp2l A C 13: 41,153,476 D125A Het
Tmem169 A G 1: 72,301,007 T199A probably damaging Het
Tnip1 A G 11: 54,936,465 M157T probably benign Het
Tubb3 A G 8: 123,421,029 S234G probably damaging Het
Ubtd2 A G 11: 32,499,267 K38R possibly damaging Het
Unc13a A C 8: 71,645,761 F1127V possibly damaging Het
Wdpcp G A 11: 21,721,205 W482* probably null Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30115240 missense probably damaging 1.00
IGL01016:Gldc APN 19 30133493 missense possibly damaging 0.93
IGL01112:Gldc APN 19 30158513 critical splice donor site probably null
IGL01510:Gldc APN 19 30113721 critical splice donor site probably null
IGL01516:Gldc APN 19 30099032 missense probably damaging 1.00
IGL01598:Gldc APN 19 30133756 missense probably damaging 1.00
IGL01646:Gldc APN 19 30100765 missense possibly damaging 0.61
IGL02024:Gldc APN 19 30100827 missense probably damaging 1.00
IGL02125:Gldc APN 19 30147241 missense probably benign 0.03
IGL02548:Gldc APN 19 30099899 missense probably benign
IGL02711:Gldc APN 19 30145146 critical splice donor site probably null
IGL02818:Gldc APN 19 30136509 missense probably damaging 0.99
IGL02982:Gldc APN 19 30145145 critical splice donor site probably null
IGL03165:Gldc APN 19 30098993 missense possibly damaging 0.61
jojoba UTSW 19 30133512 missense probably damaging 1.00
miserable UTSW 19 30151536 missense probably damaging 1.00
Urchin UTSW 19 30118602 missense probably damaging 0.98
I2289:Gldc UTSW 19 30147176 nonsense probably null
R0180:Gldc UTSW 19 30100817 missense possibly damaging 0.95
R0269:Gldc UTSW 19 30118602 missense probably damaging 0.98
R0277:Gldc UTSW 19 30116451 missense possibly damaging 0.84
R1085:Gldc UTSW 19 30151428 missense probably damaging 1.00
R1159:Gldc UTSW 19 30160762 intron probably benign
R1500:Gldc UTSW 19 30113825 missense possibly damaging 0.88
R1507:Gldc UTSW 19 30118638 missense probably damaging 1.00
R1592:Gldc UTSW 19 30160677 intron probably benign
R1593:Gldc UTSW 19 30113750 missense probably damaging 1.00
R1675:Gldc UTSW 19 30143453 missense probably damaging 1.00
R1869:Gldc UTSW 19 30139332 missense probably benign
R1965:Gldc UTSW 19 30137113 nonsense probably null
R2312:Gldc UTSW 19 30100826 missense probably damaging 0.98
R2425:Gldc UTSW 19 30131790 missense probably damaging 1.00
R3836:Gldc UTSW 19 30118675 splice site probably benign
R3837:Gldc UTSW 19 30118675 splice site probably benign
R3839:Gldc UTSW 19 30118675 splice site probably benign
R4191:Gldc UTSW 19 30145658 missense probably damaging 0.96
R4380:Gldc UTSW 19 30160768 intron probably benign
R4508:Gldc UTSW 19 30143407 missense probably damaging 1.00
R4570:Gldc UTSW 19 30174439 missense probably benign
R4655:Gldc UTSW 19 30160702 intron probably benign
R4842:Gldc UTSW 19 30133732 missense possibly damaging 0.94
R5070:Gldc UTSW 19 30118598 missense possibly damaging 0.84
R5085:Gldc UTSW 19 30151536 missense probably damaging 1.00
R5268:Gldc UTSW 19 30145725 missense probably damaging 0.96
R5368:Gldc UTSW 19 30158521 missense probably benign
R5718:Gldc UTSW 19 30110772 nonsense probably null
R5878:Gldc UTSW 19 30143467 splice site probably null
R6192:Gldc UTSW 19 30133772 missense probably damaging 0.98
R6453:Gldc UTSW 19 30116517 missense probably damaging 0.99
R6777:Gldc UTSW 19 30133512 missense probably damaging 1.00
R6865:Gldc UTSW 19 30133762 missense possibly damaging 0.92
R7332:Gldc UTSW 19 30116526 missense probably damaging 0.99
R7390:Gldc UTSW 19 30099914 missense possibly damaging 0.46
R7647:Gldc UTSW 19 30118667 missense probably damaging 0.96
R8081:Gldc UTSW 19 30158587 frame shift probably null
R8171:Gldc UTSW 19 30133761 missense probably benign 0.24
R8321:Gldc UTSW 19 30143407 nonsense probably null
R8374:Gldc UTSW 19 30137194 missense probably damaging 1.00
R8510:Gldc UTSW 19 30116505 missense probably damaging 1.00
R8785:Gldc UTSW 19 30115234 missense probably damaging 1.00
R8818:Gldc UTSW 19 30100812 missense probably benign 0.05
R8820:Gldc UTSW 19 30100812 missense probably benign 0.05
R8829:Gldc UTSW 19 30100812 missense probably benign 0.05
R8830:Gldc UTSW 19 30100812 missense probably benign 0.05
R8859:Gldc UTSW 19 30139379 missense probably damaging 1.00
Z1177:Gldc UTSW 19 30110778 missense probably damaging 1.00
Z1177:Gldc UTSW 19 30110779 missense probably damaging 0.99
Z1177:Gldc UTSW 19 30145748 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AATGAGCTCAGATGACCCTTGAG -3'
(R):5'- CGTGTCACTGTGTGCATAATG -3'

Sequencing Primer
(F):5'- CTTGAGGGCTGTCTGACTCC -3'
(R):5'- CGTGTCACTGTGTGCATAATGTAAAC -3'
Posted On2020-10-20