Incidental Mutation 'R8503:Gldc'
ID 655437
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Name glycine decarboxylase
Synonyms b2b2679Clo, D030049L12Rik, D19Wsu57e
MMRRC Submission 067943-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8503 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 30075847-30152829 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30077254 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 973 (V973I)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
AlphaFold Q91W43
Predicted Effect probably benign
Transcript: ENSMUST00000025778
AA Change: V973I

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: V973I

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd2 C A 3: 107,987,432 (GRCm39) V134L probably benign Het
Arsk A T 13: 76,239,830 (GRCm39) Y124* probably null Het
Atm A G 9: 53,399,352 (GRCm39) Y1550H probably damaging Het
Atp10b A G 11: 43,113,066 (GRCm39) T871A possibly damaging Het
Birc6 T A 17: 74,999,239 (GRCm39) Y4656N probably damaging Het
Bpifa3 C A 2: 153,972,550 (GRCm39) A32D probably damaging Het
Casp12 T C 9: 5,346,739 (GRCm39) probably benign Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Cntnap2 A G 6: 45,968,975 (GRCm39) E239G probably damaging Het
Cped1 C T 6: 22,145,564 (GRCm39) L641F probably benign Het
Cr2 G A 1: 194,845,850 (GRCm39) P35L probably benign Het
Cyp4f15 T A 17: 32,914,338 (GRCm39) C211S probably damaging Het
Defa29 T A 8: 21,815,903 (GRCm39) probably benign Het
Eif2b5 T C 16: 20,317,730 (GRCm39) S23P probably benign Het
Fam151a T C 4: 106,603,377 (GRCm39) F313L possibly damaging Het
Fggy T A 4: 95,790,295 (GRCm39) probably benign Het
Glipr1l2 A C 10: 111,943,075 (GRCm39) E310A probably benign Het
Gpr85 G A 6: 13,836,829 (GRCm39) T25I probably benign Het
Grin2a T A 16: 9,481,413 (GRCm39) I463F probably damaging Het
Hoxd10 T C 2: 74,522,724 (GRCm39) L134P probably benign Het
Kif3b T G 2: 153,162,824 (GRCm39) probably null Het
Klra17 T C 6: 129,845,777 (GRCm39) I146V probably benign Het
Lhpp A G 7: 132,307,406 (GRCm39) T268A probably benign Het
Mab21l1 G T 3: 55,690,604 (GRCm39) E64* probably null Het
Nipal3 C T 4: 135,206,892 (GRCm39) A101T probably damaging Het
Nlgn1 A T 3: 26,187,522 (GRCm39) I121N probably damaging Het
Nuggc G A 14: 65,878,797 (GRCm39) probably null Het
Obscn T C 11: 58,891,443 (GRCm39) M7030V unknown Het
Or10g1b A G 14: 52,627,354 (GRCm39) I292T probably damaging Het
Or12e1 T A 2: 87,022,653 (GRCm39) Y207* probably null Het
Or6c211 T C 10: 129,505,512 (GRCm39) N292S probably damaging Het
Otogl A G 10: 107,727,987 (GRCm39) C245R probably damaging Het
Papolg C T 11: 23,820,292 (GRCm39) V433I probably benign Het
Pcdh12 A G 18: 38,415,574 (GRCm39) V517A possibly damaging Het
Pds5b A G 5: 150,639,972 (GRCm39) E29G possibly damaging Het
Phlpp1 T C 1: 106,320,019 (GRCm39) I1338T probably benign Het
Pom121 T A 5: 135,410,398 (GRCm39) S920C unknown Het
Prdm16 A G 4: 154,426,009 (GRCm39) V592A probably benign Het
R3hdm2 T A 10: 127,328,481 (GRCm39) N734K possibly damaging Het
Rpa2 G C 4: 132,501,180 (GRCm39) V126L probably benign Het
Sash1 A T 10: 8,656,277 (GRCm39) probably benign Het
Shmt2 C T 10: 127,354,789 (GRCm39) V299I probably benign Het
Sp3 T A 2: 72,768,645 (GRCm39) Q706L probably benign Het
Sycp2l A C 13: 41,306,952 (GRCm39) D125A Het
Tmem169 A G 1: 72,340,166 (GRCm39) T199A probably damaging Het
Tnip1 A G 11: 54,827,291 (GRCm39) M157T probably benign Het
Tsbp1 T C 17: 34,667,100 (GRCm39) probably benign Het
Tubb3 A G 8: 124,147,768 (GRCm39) S234G probably damaging Het
Ubtd2 A G 11: 32,449,267 (GRCm39) K38R possibly damaging Het
Unc13a A C 8: 72,098,405 (GRCm39) F1127V possibly damaging Het
Wdpcp G A 11: 21,671,205 (GRCm39) W482* probably null Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30,092,640 (GRCm39) missense probably damaging 1.00
IGL01016:Gldc APN 19 30,110,893 (GRCm39) missense possibly damaging 0.93
IGL01112:Gldc APN 19 30,135,913 (GRCm39) critical splice donor site probably null
IGL01510:Gldc APN 19 30,091,121 (GRCm39) critical splice donor site probably null
IGL01516:Gldc APN 19 30,076,432 (GRCm39) missense probably damaging 1.00
IGL01598:Gldc APN 19 30,111,156 (GRCm39) missense probably damaging 1.00
IGL01646:Gldc APN 19 30,078,165 (GRCm39) missense possibly damaging 0.61
IGL02024:Gldc APN 19 30,078,227 (GRCm39) missense probably damaging 1.00
IGL02125:Gldc APN 19 30,124,641 (GRCm39) missense probably benign 0.03
IGL02548:Gldc APN 19 30,077,299 (GRCm39) missense probably benign
IGL02711:Gldc APN 19 30,122,546 (GRCm39) critical splice donor site probably null
IGL02818:Gldc APN 19 30,113,909 (GRCm39) missense probably damaging 0.99
IGL02982:Gldc APN 19 30,122,545 (GRCm39) critical splice donor site probably null
IGL03165:Gldc APN 19 30,076,393 (GRCm39) missense possibly damaging 0.61
jojoba UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
miserable UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
Urchin UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
I2289:Gldc UTSW 19 30,124,576 (GRCm39) nonsense probably null
R0180:Gldc UTSW 19 30,078,217 (GRCm39) missense possibly damaging 0.95
R0269:Gldc UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
R0277:Gldc UTSW 19 30,093,851 (GRCm39) missense possibly damaging 0.84
R1085:Gldc UTSW 19 30,128,828 (GRCm39) missense probably damaging 1.00
R1159:Gldc UTSW 19 30,138,162 (GRCm39) intron probably benign
R1500:Gldc UTSW 19 30,091,225 (GRCm39) missense possibly damaging 0.88
R1507:Gldc UTSW 19 30,096,038 (GRCm39) missense probably damaging 1.00
R1592:Gldc UTSW 19 30,138,077 (GRCm39) intron probably benign
R1593:Gldc UTSW 19 30,091,150 (GRCm39) missense probably damaging 1.00
R1675:Gldc UTSW 19 30,120,853 (GRCm39) missense probably damaging 1.00
R1869:Gldc UTSW 19 30,116,732 (GRCm39) missense probably benign
R1965:Gldc UTSW 19 30,114,513 (GRCm39) nonsense probably null
R2312:Gldc UTSW 19 30,078,226 (GRCm39) missense probably damaging 0.98
R2425:Gldc UTSW 19 30,109,190 (GRCm39) missense probably damaging 1.00
R3836:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3837:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3839:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R4191:Gldc UTSW 19 30,123,058 (GRCm39) missense probably damaging 0.96
R4380:Gldc UTSW 19 30,138,168 (GRCm39) intron probably benign
R4508:Gldc UTSW 19 30,120,807 (GRCm39) missense probably damaging 1.00
R4570:Gldc UTSW 19 30,151,839 (GRCm39) missense probably benign
R4655:Gldc UTSW 19 30,138,102 (GRCm39) intron probably benign
R4842:Gldc UTSW 19 30,111,132 (GRCm39) missense possibly damaging 0.94
R5070:Gldc UTSW 19 30,095,998 (GRCm39) missense possibly damaging 0.84
R5085:Gldc UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
R5268:Gldc UTSW 19 30,123,125 (GRCm39) missense probably damaging 0.96
R5368:Gldc UTSW 19 30,135,921 (GRCm39) missense probably benign
R5718:Gldc UTSW 19 30,088,172 (GRCm39) nonsense probably null
R5878:Gldc UTSW 19 30,120,867 (GRCm39) splice site probably null
R6192:Gldc UTSW 19 30,111,172 (GRCm39) missense probably damaging 0.98
R6453:Gldc UTSW 19 30,093,917 (GRCm39) missense probably damaging 0.99
R6777:Gldc UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
R6865:Gldc UTSW 19 30,111,162 (GRCm39) missense possibly damaging 0.92
R7332:Gldc UTSW 19 30,093,926 (GRCm39) missense probably damaging 0.99
R7390:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.46
R7647:Gldc UTSW 19 30,096,067 (GRCm39) missense probably damaging 0.96
R8081:Gldc UTSW 19 30,135,987 (GRCm39) frame shift probably null
R8171:Gldc UTSW 19 30,111,161 (GRCm39) missense probably benign 0.24
R8321:Gldc UTSW 19 30,120,807 (GRCm39) nonsense probably null
R8374:Gldc UTSW 19 30,114,594 (GRCm39) missense probably damaging 1.00
R8510:Gldc UTSW 19 30,093,905 (GRCm39) missense probably damaging 1.00
R8785:Gldc UTSW 19 30,092,634 (GRCm39) missense probably damaging 1.00
R8818:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8820:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8829:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8830:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8859:Gldc UTSW 19 30,116,779 (GRCm39) missense probably damaging 1.00
R8887:Gldc UTSW 19 30,111,156 (GRCm39) missense possibly damaging 0.94
R8935:Gldc UTSW 19 30,109,093 (GRCm39) missense probably benign 0.00
R8940:Gldc UTSW 19 30,128,884 (GRCm39) missense probably benign
R9070:Gldc UTSW 19 30,080,404 (GRCm39) missense probably damaging 1.00
R9100:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.81
R9144:Gldc UTSW 19 30,114,593 (GRCm39) missense
R9163:Gldc UTSW 19 30,111,686 (GRCm39) missense probably benign 0.13
R9429:Gldc UTSW 19 30,091,172 (GRCm39) missense possibly damaging 0.88
Z1177:Gldc UTSW 19 30,123,148 (GRCm39) missense possibly damaging 0.61
Z1177:Gldc UTSW 19 30,088,179 (GRCm39) missense probably damaging 0.99
Z1177:Gldc UTSW 19 30,088,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGAGCTCAGATGACCCTTGAG -3'
(R):5'- CGTGTCACTGTGTGCATAATG -3'

Sequencing Primer
(F):5'- CTTGAGGGCTGTCTGACTCC -3'
(R):5'- CGTGTCACTGTGTGCATAATGTAAAC -3'
Posted On 2020-10-20