Incidental Mutation 'R8504:Slco4a1'
ID 655447
Institutional Source Beutler Lab
Gene Symbol Slco4a1
Ensembl Gene ENSMUSG00000038963
Gene Name solute carrier organic anion transporter family, member 4a1
Synonyms Slc21a12, OATP-E
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock # R8504 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 180456245-180474867 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 180464799 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 258 (V258A)
Ref Sequence ENSEMBL: ENSMUSP00000045023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038225] [ENSMUST00000038259]
AlphaFold Q8K078
Predicted Effect probably damaging
Transcript: ENSMUST00000038225
AA Change: V258A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045023
Gene: ENSMUSG00000038963
AA Change: V258A

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:OATP 103 665 5.7e-168 PFAM
Pfam:MFS_1 105 496 3e-15 PFAM
Pfam:Kazal_2 512 555 1.1e-7 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000038259
AA Change: V258A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046502
Gene: ENSMUSG00000038963
AA Change: V258A

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:OATP 101 666 2.8e-172 PFAM
Pfam:MFS_1 105 496 2.5e-15 PFAM
Pfam:Kazal_2 512 555 7.7e-8 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,129,334 S1181P probably benign Het
Acvr1c C T 2: 58,283,479 C337Y probably damaging Het
Adgrf5 A G 17: 43,446,949 E758G probably benign Het
Akap3 T A 6: 126,864,530 D37E probably damaging Het
Ano5 A T 7: 51,573,028 H445L probably benign Het
Ap4b1 T A 3: 103,812,800 I121N probably damaging Het
Arhgdia T C 11: 120,579,528 K135E probably benign Het
Ass1 T C 2: 31,501,532 F273S possibly damaging Het
Atp8a2 A C 14: 59,647,917 Y1119* probably null Het
Birc6 T A 17: 74,652,005 M3839K probably damaging Het
Cacna1a A G 8: 84,638,741 H2171R probably benign Het
Ccdc105 T C 10: 78,749,204 D266G probably benign Het
Ccdc105 T C 10: 78,750,629 D196G probably damaging Het
Ccdc90b T A 7: 92,575,337 D183E probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdh23 T A 10: 60,438,839 T491S probably benign Het
Cercam T C 2: 29,881,817 S550P possibly damaging Het
Chd9 A G 8: 90,996,844 H1019R unknown Het
Coil A T 11: 88,981,154 K114* probably null Het
Csmd2 A C 4: 128,546,690 T3183P Het
Cul9 T C 17: 46,503,580 Y2219C probably damaging Het
Efhd2 G A 4: 141,859,875 Q199* probably null Het
Elp3 A T 14: 65,547,911 S499R probably benign Het
Exoc8 T G 8: 124,895,970 I553L probably benign Het
Fyco1 C A 9: 123,830,077 V345L probably benign Het
Galr3 T A 15: 79,043,079 V240E probably damaging Het
Gm21190 A G 5: 15,525,864 S165P probably benign Het
Gnal T A 18: 67,217,184 Y372* probably null Het
H2-DMa A G 17: 34,138,442 N230D probably damaging Het
Hk2 T C 6: 82,744,866 D164G possibly damaging Het
Ighv3-4 T A 12: 114,253,924 I16F possibly damaging Het
Ivl T C 3: 92,572,771 probably benign Het
Klhl8 G A 5: 103,867,948 T434M probably benign Het
Lct A T 1: 128,287,569 S1757T probably damaging Het
Lmbr1l T A 15: 98,912,184 Y132F probably damaging Het
M6pr T C 6: 122,316,070 V203A possibly damaging Het
Map9 T C 3: 82,377,169 probably null Het
Muc5ac A T 7: 141,807,155 D1401V probably damaging Het
Myh7 A G 14: 54,990,329 S291P probably damaging Het
Nynrin G C 14: 55,870,246 V937L probably benign Het
Olfr1032 T G 2: 86,007,805 F10V probably damaging Het
Olfr1174-ps C T 2: 88,311,481 G105D probably benign Het
Pank2 A G 2: 131,293,400 N386S probably benign Het
Phkg2 G T 7: 127,582,356 R237L possibly damaging Het
Pkhd1 C T 1: 20,520,208 V1772I probably benign Het
Plch2 G T 4: 154,984,395 P1258Q probably benign Het
Plekhm2 A T 4: 141,642,453 I77N probably damaging Het
Ptprb A G 10: 116,341,031 T954A probably benign Het
Ranbp3 T C 17: 56,708,273 V325A probably damaging Het
Rgs10 A T 7: 128,418,069 S16T probably benign Het
Scaper A T 9: 55,864,438 V398E probably benign Het
Selenot A G 3: 58,585,277 I62V probably benign Het
Serpinb9e T A 13: 33,255,109 C173S probably benign Het
Slc13a3 G T 2: 165,434,079 T249K probably damaging Het
Slc4a8 T A 15: 100,803,290 V741D possibly damaging Het
Sycp2l T G 13: 41,137,914 L256R probably damaging Het
Top2a C T 11: 99,014,741 V337I probably benign Het
Unc13a A C 8: 71,645,761 F1127V possibly damaging Het
Wdr25 C T 12: 109,026,467 Q435* probably null Het
Zc3h7b T G 15: 81,780,518 L526R probably damaging Het
Zcchc11 T C 4: 108,530,942 L1160P probably damaging Het
Zeb1 C A 18: 5,705,127 T48K possibly damaging Het
Zfhx2 A C 14: 55,065,786 S1580R probably benign Het
Zfhx3 A G 8: 108,856,917 I1139V possibly damaging Het
Zfp536 C A 7: 37,480,067 V1038L probably benign Het
Zfp759 T A 13: 67,138,883 V166E probably benign Het
Zfp985 A T 4: 147,583,426 K250N possibly damaging Het
Other mutations in Slco4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Slco4a1 APN 2 180464679 missense probably damaging 1.00
IGL01982:Slco4a1 APN 2 180473153 missense probably benign 0.03
IGL02297:Slco4a1 APN 2 180464489 missense probably benign 0.16
IGL02368:Slco4a1 APN 2 180473128 missense probably damaging 0.98
conduit UTSW 2 180473615 missense probably damaging 1.00
ingress UTSW 2 180465677 missense probably benign
R1621:Slco4a1 UTSW 2 180471132 missense probably benign 0.01
R2275:Slco4a1 UTSW 2 180464736 missense possibly damaging 0.94
R2472:Slco4a1 UTSW 2 180467087 missense probably damaging 1.00
R3851:Slco4a1 UTSW 2 180464091 missense probably benign 0.00
R3852:Slco4a1 UTSW 2 180464091 missense probably benign 0.00
R4271:Slco4a1 UTSW 2 180474210 missense possibly damaging 0.85
R4439:Slco4a1 UTSW 2 180472662 missense probably benign 0.02
R4571:Slco4a1 UTSW 2 180464378 missense probably benign 0.32
R4732:Slco4a1 UTSW 2 180473615 missense probably damaging 1.00
R4733:Slco4a1 UTSW 2 180473615 missense probably damaging 1.00
R4925:Slco4a1 UTSW 2 180472056 missense probably benign 0.35
R5156:Slco4a1 UTSW 2 180472779 missense probably benign 0.01
R5186:Slco4a1 UTSW 2 180473108 missense probably damaging 1.00
R5252:Slco4a1 UTSW 2 180464459 missense possibly damaging 0.48
R5426:Slco4a1 UTSW 2 180471235 missense possibly damaging 0.84
R5470:Slco4a1 UTSW 2 180474114 missense probably benign 0.00
R5512:Slco4a1 UTSW 2 180474114 missense possibly damaging 0.91
R6969:Slco4a1 UTSW 2 180464808 missense probably benign
R7133:Slco4a1 UTSW 2 180472063 missense possibly damaging 0.93
R7249:Slco4a1 UTSW 2 180464811 missense probably benign 0.01
R7357:Slco4a1 UTSW 2 180472137 missense probably benign 0.00
R7442:Slco4a1 UTSW 2 180474126 missense probably benign
R7599:Slco4a1 UTSW 2 180471255 missense probably benign
R7750:Slco4a1 UTSW 2 180471237 missense probably benign 0.30
R7834:Slco4a1 UTSW 2 180465677 missense probably benign
R8203:Slco4a1 UTSW 2 180464799 missense probably damaging 0.96
R9166:Slco4a1 UTSW 2 180464241 missense probably benign 0.00
R9170:Slco4a1 UTSW 2 180464685 missense probably benign 0.00
R9210:Slco4a1 UTSW 2 180472478 missense probably damaging 1.00
Z1177:Slco4a1 UTSW 2 180464381 missense possibly damaging 0.85
Z1177:Slco4a1 UTSW 2 180464564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTCCCTGGTATTTGCACTG -3'
(R):5'- GTAGCTTAGGGACACTTGGATC -3'

Sequencing Primer
(F):5'- CGGCCGCTATGAGGTAGAG -3'
(R):5'- ACACTTGGATCATATGGCCG -3'
Posted On 2020-10-20