Incidental Mutation 'R8504:Plekhm2'
ID655455
Institutional Source Beutler Lab
Gene Symbol Plekhm2
Ensembl Gene ENSMUSG00000028917
Gene Namepleckstrin homology domain containing, family M (with RUN domain) member 2
Synonyms2310034J19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8504 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location141625734-141664899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141642453 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 77 (I77N)
Ref Sequence ENSEMBL: ENSMUSP00000030751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030751] [ENSMUST00000084203]
Predicted Effect probably damaging
Transcript: ENSMUST00000030751
AA Change: I77N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030751
Gene: ENSMUSG00000028917
AA Change: I77N

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 230 246 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
low complexity region 485 495 N/A INTRINSIC
low complexity region 505 538 N/A INTRINSIC
Blast:PH 596 656 7e-31 BLAST
PH 766 869 2.43e-12 SMART
Blast:PH 879 960 6e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000084203
AA Change: I77N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081221
Gene: ENSMUSG00000028917
AA Change: I77N

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 250 266 N/A INTRINSIC
low complexity region 315 327 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
low complexity region 525 558 N/A INTRINSIC
Blast:PH 616 676 7e-31 BLAST
PH 786 889 2.43e-12 SMART
Blast:PH 899 980 6e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the plus-end directed microtubule motor protein kinesin, together with the lysosomal GTPase Arl8, and is required for lysosomes to distribute away from the microtubule-organizing center. The encoded protein belongs to the multisubunit BLOC-one-related complex that regulates lysosome positioning. It binds a Salmonella effector protein called Salmonella induced filament A and is a critical host determinant in Salmonella pathogenesis. It has a domain architecture consisting of an N-terminal RPIP8, UNC-14, and NESCA (RUN) domain that binds kinesin-1 as well as the lysosomal GTPase Arl8, and a C-terminal pleckstrin homology domain that binds the Salmonella induced filament A effector protein. Naturally occurring mutations in this gene lead to abnormal localization of lysosomes, impaired autophagy flux and are associated with recessive dilated cardiomyopathy and left ventricular noncompaction. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased leukocyte numbers and decreased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,129,334 S1181P probably benign Het
Acvr1c C T 2: 58,283,479 C337Y probably damaging Het
Adgrf5 A G 17: 43,446,949 E758G probably benign Het
Akap3 T A 6: 126,864,530 D37E probably damaging Het
Ano5 A T 7: 51,573,028 H445L probably benign Het
Ap4b1 T A 3: 103,812,800 I121N probably damaging Het
Arhgdia T C 11: 120,579,528 K135E probably benign Het
Ass1 T C 2: 31,501,532 F273S possibly damaging Het
Atp8a2 A C 14: 59,647,917 Y1119* probably null Het
Birc6 T A 17: 74,652,005 M3839K probably damaging Het
Cacna1a A G 8: 84,638,741 H2171R probably benign Het
Ccdc105 T C 10: 78,749,204 D266G probably benign Het
Ccdc105 T C 10: 78,750,629 D196G probably damaging Het
Ccdc90b T A 7: 92,575,337 D183E probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdh23 T A 10: 60,438,839 T491S probably benign Het
Cercam T C 2: 29,881,817 S550P possibly damaging Het
Chd9 A G 8: 90,996,844 H1019R unknown Het
Coil A T 11: 88,981,154 K114* probably null Het
Csmd2 A C 4: 128,546,690 T3183P Het
Cul9 T C 17: 46,503,580 Y2219C probably damaging Het
Efhd2 G A 4: 141,859,875 Q199* probably null Het
Elp3 A T 14: 65,547,911 S499R probably benign Het
Exoc8 T G 8: 124,895,970 I553L probably benign Het
Fyco1 C A 9: 123,830,077 V345L probably benign Het
Galr3 T A 15: 79,043,079 V240E probably damaging Het
Gm21190 A G 5: 15,525,864 S165P probably benign Het
Gnal T A 18: 67,217,184 Y372* probably null Het
H2-DMa A G 17: 34,138,442 N230D probably damaging Het
Hk2 T C 6: 82,744,866 D164G possibly damaging Het
Ighv3-4 T A 12: 114,253,924 I16F possibly damaging Het
Ivl T C 3: 92,572,771 probably benign Het
Klhl8 G A 5: 103,867,948 T434M probably benign Het
Lct A T 1: 128,287,569 S1757T probably damaging Het
Lmbr1l T A 15: 98,912,184 Y132F probably damaging Het
M6pr T C 6: 122,316,070 V203A possibly damaging Het
Map9 T C 3: 82,377,169 probably null Het
Muc5ac A T 7: 141,807,155 D1401V probably damaging Het
Myh7 A G 14: 54,990,329 S291P probably damaging Het
Nynrin G C 14: 55,870,246 V937L probably benign Het
Olfr1032 T G 2: 86,007,805 F10V probably damaging Het
Olfr1174-ps C T 2: 88,311,481 G105D probably benign Het
Pank2 A G 2: 131,293,400 N386S probably benign Het
Phkg2 G T 7: 127,582,356 R237L possibly damaging Het
Pkhd1 C T 1: 20,520,208 V1772I probably benign Het
Plch2 G T 4: 154,984,395 P1258Q probably benign Het
Ptprb A G 10: 116,341,031 T954A probably benign Het
Ranbp3 T C 17: 56,708,273 V325A probably damaging Het
Rgs10 A T 7: 128,418,069 S16T probably benign Het
Scaper A T 9: 55,864,438 V398E probably benign Het
Selenot A G 3: 58,585,277 I62V probably benign Het
Serpinb9e T A 13: 33,255,109 C173S probably benign Het
Slc13a3 G T 2: 165,434,079 T249K probably damaging Het
Slc4a8 T A 15: 100,803,290 V741D possibly damaging Het
Slco4a1 T C 2: 180,464,799 V258A probably damaging Het
Sycp2l T G 13: 41,137,914 L256R probably damaging Het
Top2a C T 11: 99,014,741 V337I probably benign Het
Unc13a A C 8: 71,645,761 F1127V possibly damaging Het
Wdr25 C T 12: 109,026,467 Q435* probably null Het
Zc3h7b T G 15: 81,780,518 L526R probably damaging Het
Zcchc11 T C 4: 108,530,942 L1160P probably damaging Het
Zeb1 C A 18: 5,705,127 T48K possibly damaging Het
Zfhx2 A C 14: 55,065,786 S1580R probably benign Het
Zfhx3 A G 8: 108,856,917 I1139V possibly damaging Het
Zfp536 C A 7: 37,480,067 V1038L probably benign Het
Zfp759 T A 13: 67,138,883 V166E probably benign Het
Zfp985 A T 4: 147,583,426 K250N possibly damaging Het
Other mutations in Plekhm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Plekhm2 APN 4 141642645 splice site probably null
IGL01388:Plekhm2 APN 4 141642001 missense probably damaging 1.00
IGL01392:Plekhm2 APN 4 141642426 missense probably damaging 0.98
IGL01482:Plekhm2 APN 4 141630029 missense probably damaging 0.98
IGL01828:Plekhm2 APN 4 141629585 missense probably benign 0.11
IGL02010:Plekhm2 APN 4 141637419 splice site probably benign
IGL02075:Plekhm2 APN 4 141628306 missense probably benign 0.38
IGL02381:Plekhm2 APN 4 141642723 missense possibly damaging 0.95
IGL02543:Plekhm2 APN 4 141642019 missense probably benign 0.02
IGL02747:Plekhm2 APN 4 141634272 missense possibly damaging 0.55
IGL02802:Plekhm2 APN 4 141642524 splice site probably benign
IGL02828:Plekhm2 APN 4 141629630 missense probably damaging 1.00
IGL03286:Plekhm2 APN 4 141634347 missense possibly damaging 0.95
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0639:Plekhm2 UTSW 4 141642070 missense probably damaging 1.00
R0682:Plekhm2 UTSW 4 141628125 missense probably damaging 0.97
R0968:Plekhm2 UTSW 4 141629932 missense probably benign 0.01
R1109:Plekhm2 UTSW 4 141627984 missense probably benign 0.31
R1475:Plekhm2 UTSW 4 141627854 missense possibly damaging 0.75
R1802:Plekhm2 UTSW 4 141634347 missense probably benign 0.03
R1813:Plekhm2 UTSW 4 141642439 missense possibly damaging 0.93
R1844:Plekhm2 UTSW 4 141632374 missense probably benign
R2261:Plekhm2 UTSW 4 141642732 missense probably damaging 0.98
R3889:Plekhm2 UTSW 4 141641990 splice site probably benign
R3922:Plekhm2 UTSW 4 141629532 missense probably benign 0.01
R4324:Plekhm2 UTSW 4 141631857 missense possibly damaging 0.86
R4758:Plekhm2 UTSW 4 141642005 missense possibly damaging 0.91
R4814:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R4983:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R5468:Plekhm2 UTSW 4 141628100 missense probably damaging 1.00
R5691:Plekhm2 UTSW 4 141628289 missense possibly damaging 0.96
R5877:Plekhm2 UTSW 4 141639693 missense probably damaging 0.98
R6268:Plekhm2 UTSW 4 141632341 nonsense probably null
R6367:Plekhm2 UTSW 4 141639705 missense probably damaging 0.97
R6371:Plekhm2 UTSW 4 141629532 missense possibly damaging 0.94
R6489:Plekhm2 UTSW 4 141632033 missense probably damaging 1.00
R7266:Plekhm2 UTSW 4 141642459 missense possibly damaging 0.91
R7399:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R7573:Plekhm2 UTSW 4 141631347 missense probably benign 0.02
R7742:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R7864:Plekhm2 UTSW 4 141628046 missense probably damaging 0.96
R7920:Plekhm2 UTSW 4 141632121 missense probably damaging 1.00
R8417:Plekhm2 UTSW 4 141627825 missense probably benign 0.04
T0722:Plekhm2 UTSW 4 141631981 small deletion probably benign
T0975:Plekhm2 UTSW 4 141631981 small deletion probably benign
X0024:Plekhm2 UTSW 4 141628041 missense probably damaging 1.00
Z1177:Plekhm2 UTSW 4 141629085 missense possibly damaging 0.77
Z1177:Plekhm2 UTSW 4 141639822 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AAACTGTCACATGCAGGGG -3'
(R):5'- CTGTACGGGTGAGTTCAGTC -3'

Sequencing Primer
(F):5'- AAATGAGGCTCTGCGGA -3'
(R):5'- GGGTGAGTTCAGTCCCCTC -3'
Posted On2020-10-20