Incidental Mutation 'R8504:Atp8a2'
ID655493
Institutional Source Beutler Lab
Gene Symbol Atp8a2
Ensembl Gene ENSMUSG00000021983
Gene NameATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Synonymswl, Ib
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R8504 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location59638540-60197179 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 59647917 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1119 (Y1119*)
Ref Sequence ENSEMBL: ENSMUSP00000079238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080368]
Predicted Effect probably null
Transcript: ENSMUST00000080368
AA Change: Y1119*
SMART Domains Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983
AA Change: Y1119*

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 14 80 2.3e-27 PFAM
Pfam:E1-E2_ATPase 85 348 6.7e-15 PFAM
Pfam:HAD 385 790 3.2e-22 PFAM
Pfam:Cation_ATPase 465 564 3.2e-14 PFAM
Pfam:PhoLip_ATPase_C 807 1059 2.8e-79 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,129,334 S1181P probably benign Het
Acvr1c C T 2: 58,283,479 C337Y probably damaging Het
Adgrf5 A G 17: 43,446,949 E758G probably benign Het
Akap3 T A 6: 126,864,530 D37E probably damaging Het
Ano5 A T 7: 51,573,028 H445L probably benign Het
Ap4b1 T A 3: 103,812,800 I121N probably damaging Het
Arhgdia T C 11: 120,579,528 K135E probably benign Het
Ass1 T C 2: 31,501,532 F273S possibly damaging Het
Birc6 T A 17: 74,652,005 M3839K probably damaging Het
Cacna1a A G 8: 84,638,741 H2171R probably benign Het
Ccdc105 T C 10: 78,749,204 D266G probably benign Het
Ccdc105 T C 10: 78,750,629 D196G probably damaging Het
Ccdc90b T A 7: 92,575,337 D183E probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdh23 T A 10: 60,438,839 T491S probably benign Het
Cercam T C 2: 29,881,817 S550P possibly damaging Het
Chd9 A G 8: 90,996,844 H1019R unknown Het
Coil A T 11: 88,981,154 K114* probably null Het
Csmd2 A C 4: 128,546,690 T3183P Het
Cul9 T C 17: 46,503,580 Y2219C probably damaging Het
Efhd2 G A 4: 141,859,875 Q199* probably null Het
Elp3 A T 14: 65,547,911 S499R probably benign Het
Exoc8 T G 8: 124,895,970 I553L probably benign Het
Fyco1 C A 9: 123,830,077 V345L probably benign Het
Galr3 T A 15: 79,043,079 V240E probably damaging Het
Gm21190 A G 5: 15,525,864 S165P probably benign Het
Gnal T A 18: 67,217,184 Y372* probably null Het
H2-DMa A G 17: 34,138,442 N230D probably damaging Het
Hk2 T C 6: 82,744,866 D164G possibly damaging Het
Ighv3-4 T A 12: 114,253,924 I16F possibly damaging Het
Ivl T C 3: 92,572,771 probably benign Het
Klhl8 G A 5: 103,867,948 T434M probably benign Het
Lct A T 1: 128,287,569 S1757T probably damaging Het
Lmbr1l T A 15: 98,912,184 Y132F probably damaging Het
M6pr T C 6: 122,316,070 V203A possibly damaging Het
Map9 T C 3: 82,377,169 probably null Het
Muc5ac A T 7: 141,807,155 D1401V probably damaging Het
Myh7 A G 14: 54,990,329 S291P probably damaging Het
Nynrin G C 14: 55,870,246 V937L probably benign Het
Olfr1032 T G 2: 86,007,805 F10V probably damaging Het
Olfr1174-ps C T 2: 88,311,481 G105D probably benign Het
Pank2 A G 2: 131,293,400 N386S probably benign Het
Phkg2 G T 7: 127,582,356 R237L possibly damaging Het
Pkhd1 C T 1: 20,520,208 V1772I probably benign Het
Plch2 G T 4: 154,984,395 P1258Q probably benign Het
Plekhm2 A T 4: 141,642,453 I77N probably damaging Het
Ptprb A G 10: 116,341,031 T954A probably benign Het
Ranbp3 T C 17: 56,708,273 V325A probably damaging Het
Rgs10 A T 7: 128,418,069 S16T probably benign Het
Scaper A T 9: 55,864,438 V398E probably benign Het
Selenot A G 3: 58,585,277 I62V probably benign Het
Serpinb9e T A 13: 33,255,109 C173S probably benign Het
Slc13a3 G T 2: 165,434,079 T249K probably damaging Het
Slc4a8 T A 15: 100,803,290 V741D possibly damaging Het
Slco4a1 T C 2: 180,464,799 V258A probably damaging Het
Sycp2l T G 13: 41,137,914 L256R probably damaging Het
Top2a C T 11: 99,014,741 V337I probably benign Het
Unc13a A C 8: 71,645,761 F1127V possibly damaging Het
Wdr25 C T 12: 109,026,467 Q435* probably null Het
Zc3h7b T G 15: 81,780,518 L526R probably damaging Het
Zcchc11 T C 4: 108,530,942 L1160P probably damaging Het
Zeb1 C A 18: 5,705,127 T48K possibly damaging Het
Zfhx2 A C 14: 55,065,786 S1580R probably benign Het
Zfhx3 A G 8: 108,856,917 I1139V possibly damaging Het
Zfp536 C A 7: 37,480,067 V1038L probably benign Het
Zfp759 T A 13: 67,138,883 V166E probably benign Het
Zfp985 A T 4: 147,583,426 K250N possibly damaging Het
Other mutations in Atp8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Atp8a2 APN 14 59691461 missense probably benign 0.00
IGL01505:Atp8a2 APN 14 60028063 missense probably benign 0.00
IGL01614:Atp8a2 APN 14 60044988 missense probably damaging 0.99
IGL01621:Atp8a2 APN 14 60015868 splice site probably benign
IGL01634:Atp8a2 APN 14 59998062 missense probably benign 0.01
IGL01672:Atp8a2 APN 14 59691533 missense probably benign 0.01
IGL01898:Atp8a2 APN 14 60023513 missense probably damaging 1.00
IGL01945:Atp8a2 APN 14 60026160 missense probably damaging 1.00
IGL02006:Atp8a2 APN 14 59857048 missense possibly damaging 0.90
IGL02089:Atp8a2 APN 14 60026920 splice site probably null
IGL02211:Atp8a2 APN 14 60027976 missense probably benign 0.00
IGL02283:Atp8a2 APN 14 60016799 missense possibly damaging 0.86
IGL02337:Atp8a2 APN 14 59998002 missense probably benign 0.32
IGL02571:Atp8a2 APN 14 60012458 splice site probably benign
IGL02795:Atp8a2 APN 14 60033742 missense probably damaging 0.96
IGL02874:Atp8a2 APN 14 59802252 missense probably damaging 1.00
IGL02999:Atp8a2 APN 14 59925122 nonsense probably null
IGL03307:Atp8a2 APN 14 60015872 critical splice donor site probably null
IGL03345:Atp8a2 APN 14 59774011 missense probably benign
PIT4431001:Atp8a2 UTSW 14 59654626 missense probably benign
R0334:Atp8a2 UTSW 14 59691512 missense probably damaging 1.00
R0368:Atp8a2 UTSW 14 59860212 missense probably damaging 1.00
R0420:Atp8a2 UTSW 14 59773744 missense probably damaging 1.00
R0684:Atp8a2 UTSW 14 60023144 missense probably benign 0.00
R0755:Atp8a2 UTSW 14 60009881 missense possibly damaging 0.96
R0853:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0908:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0991:Atp8a2 UTSW 14 59793929 missense probably benign 0.33
R1025:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1190:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1387:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1426:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1442:Atp8a2 UTSW 14 59860323 splice site probably benign
R1472:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1538:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1573:Atp8a2 UTSW 14 59860206 missense probably benign 0.00
R1620:Atp8a2 UTSW 14 59791183 missense probably benign
R1661:Atp8a2 UTSW 14 59860186 missense possibly damaging 0.80
R1673:Atp8a2 UTSW 14 59791240 missense probably benign 0.00
R1749:Atp8a2 UTSW 14 59860174 nonsense probably null
R1796:Atp8a2 UTSW 14 60020758 critical splice donor site probably null
R1815:Atp8a2 UTSW 14 60086624 missense probably damaging 1.00
R1836:Atp8a2 UTSW 14 60006366 missense possibly damaging 0.49
R1935:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1936:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1937:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R2416:Atp8a2 UTSW 14 59925008 missense probably damaging 1.00
R2760:Atp8a2 UTSW 14 59860192 missense probably benign 0.43
R3029:Atp8a2 UTSW 14 59691465 frame shift probably null
R3621:Atp8a2 UTSW 14 60026138 splice site probably null
R3768:Atp8a2 UTSW 14 60044336 missense probably benign 0.19
R3784:Atp8a2 UTSW 14 59773966 missense probably damaging 1.00
R3896:Atp8a2 UTSW 14 60026140 critical splice donor site probably null
R4009:Atp8a2 UTSW 14 60027985 missense possibly damaging 0.54
R4591:Atp8a2 UTSW 14 59654629 missense probably benign 0.03
R4866:Atp8a2 UTSW 14 59691467 missense probably damaging 1.00
R4879:Atp8a2 UTSW 14 60008469 nonsense probably null
R5059:Atp8a2 UTSW 14 59691537 missense probably benign 0.00
R5529:Atp8a2 UTSW 14 59793865 critical splice donor site probably null
R5788:Atp8a2 UTSW 14 60020793 missense probably damaging 0.96
R6126:Atp8a2 UTSW 14 60044326 missense probably benign
R6295:Atp8a2 UTSW 14 60012399 nonsense probably null
R6393:Atp8a2 UTSW 14 59773755 nonsense probably null
R6454:Atp8a2 UTSW 14 60008499 splice site probably null
R6651:Atp8a2 UTSW 14 59774021 missense probably benign 0.00
R6763:Atp8a2 UTSW 14 60008408 missense probably benign 0.12
R6767:Atp8a2 UTSW 14 60046722 missense probably damaging 1.00
R6912:Atp8a2 UTSW 14 60012410 missense probably benign 0.33
R7032:Atp8a2 UTSW 14 60017840 splice site probably null
R7243:Atp8a2 UTSW 14 59647842 missense probably benign
R7352:Atp8a2 UTSW 14 59791204 missense probably benign
R7355:Atp8a2 UTSW 14 60045004 missense possibly damaging 0.65
R7382:Atp8a2 UTSW 14 59654594 missense probably benign 0.00
R7451:Atp8a2 UTSW 14 59791181 missense probably null 0.00
R7483:Atp8a2 UTSW 14 60008375 missense probably benign 0.00
R7516:Atp8a2 UTSW 14 59857067 missense probably damaging 1.00
R7831:Atp8a2 UTSW 14 59773753 missense probably damaging 0.99
R8116:Atp8a2 UTSW 14 60026208 missense probably damaging 1.00
R8171:Atp8a2 UTSW 14 60046044 missense probably damaging 1.00
R8516:Atp8a2 UTSW 14 59691472 missense probably benign 0.00
Z1088:Atp8a2 UTSW 14 60027970 missense probably benign
Z1177:Atp8a2 UTSW 14 60006330 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCAGTCTTTGCTGACAAAACTG -3'
(R):5'- TCTGAACCATTCCCATCCGG -3'

Sequencing Primer
(F):5'- ACTGTTAACACTGTGTGCAAC -3'
(R):5'- ATCCGGGTCTCGTCAGCTC -3'
Posted On2020-10-20