Incidental Mutation 'R8504:H2-DMa'
ID 655499
Institutional Source Beutler Lab
Gene Symbol H2-DMa
Ensembl Gene ENSMUSG00000037649
Gene Name histocompatibility 2, class II, locus DMa
Synonyms H2-M alpha, H2-Ma, H-2Ma
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock # R8504 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 34135182-34139101 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34138442 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 230 (N230D)
Ref Sequence ENSEMBL: ENSMUSP00000037088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042121]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000042121
AA Change: N230D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037088
Gene: ENSMUSG00000037649
AA Change: N230D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MHC_II_alpha 42 123 2.83e-19 SMART
IGc1 142 212 5.82e-23 SMART
transmembrane domain 231 253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DMA belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta chain (DMB), both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired antigen presenting cell function, poor IgG responses to T-dependent antigens, reduced numbers of mature CD4+ T cells, and increased susceptibility to Leishmania major infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,129,334 S1181P probably benign Het
Acvr1c C T 2: 58,283,479 C337Y probably damaging Het
Adgrf5 A G 17: 43,446,949 E758G probably benign Het
Akap3 T A 6: 126,864,530 D37E probably damaging Het
Ano5 A T 7: 51,573,028 H445L probably benign Het
Ap4b1 T A 3: 103,812,800 I121N probably damaging Het
Arhgdia T C 11: 120,579,528 K135E probably benign Het
Ass1 T C 2: 31,501,532 F273S possibly damaging Het
Atp8a2 A C 14: 59,647,917 Y1119* probably null Het
Birc6 T A 17: 74,652,005 M3839K probably damaging Het
Cacna1a A G 8: 84,638,741 H2171R probably benign Het
Ccdc105 T C 10: 78,749,204 D266G probably benign Het
Ccdc105 T C 10: 78,750,629 D196G probably damaging Het
Ccdc90b T A 7: 92,575,337 D183E probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdh23 T A 10: 60,438,839 T491S probably benign Het
Cercam T C 2: 29,881,817 S550P possibly damaging Het
Chd9 A G 8: 90,996,844 H1019R unknown Het
Coil A T 11: 88,981,154 K114* probably null Het
Csmd2 A C 4: 128,546,690 T3183P Het
Cul9 T C 17: 46,503,580 Y2219C probably damaging Het
Efhd2 G A 4: 141,859,875 Q199* probably null Het
Elp3 A T 14: 65,547,911 S499R probably benign Het
Exoc8 T G 8: 124,895,970 I553L probably benign Het
Fyco1 C A 9: 123,830,077 V345L probably benign Het
Galr3 T A 15: 79,043,079 V240E probably damaging Het
Gm21190 A G 5: 15,525,864 S165P probably benign Het
Gnal T A 18: 67,217,184 Y372* probably null Het
Hk2 T C 6: 82,744,866 D164G possibly damaging Het
Ighv3-4 T A 12: 114,253,924 I16F possibly damaging Het
Ivl T C 3: 92,572,771 probably benign Het
Klhl8 G A 5: 103,867,948 T434M probably benign Het
Lct A T 1: 128,287,569 S1757T probably damaging Het
Lmbr1l T A 15: 98,912,184 Y132F probably damaging Het
M6pr T C 6: 122,316,070 V203A possibly damaging Het
Map9 T C 3: 82,377,169 probably null Het
Muc5ac A T 7: 141,807,155 D1401V probably damaging Het
Myh7 A G 14: 54,990,329 S291P probably damaging Het
Nynrin G C 14: 55,870,246 V937L probably benign Het
Olfr1032 T G 2: 86,007,805 F10V probably damaging Het
Olfr1174-ps C T 2: 88,311,481 G105D probably benign Het
Pank2 A G 2: 131,293,400 N386S probably benign Het
Phkg2 G T 7: 127,582,356 R237L possibly damaging Het
Pkhd1 C T 1: 20,520,208 V1772I probably benign Het
Plch2 G T 4: 154,984,395 P1258Q probably benign Het
Plekhm2 A T 4: 141,642,453 I77N probably damaging Het
Ptprb A G 10: 116,341,031 T954A probably benign Het
Ranbp3 T C 17: 56,708,273 V325A probably damaging Het
Rgs10 A T 7: 128,418,069 S16T probably benign Het
Scaper A T 9: 55,864,438 V398E probably benign Het
Selenot A G 3: 58,585,277 I62V probably benign Het
Serpinb9e T A 13: 33,255,109 C173S probably benign Het
Slc13a3 G T 2: 165,434,079 T249K probably damaging Het
Slc4a8 T A 15: 100,803,290 V741D possibly damaging Het
Slco4a1 T C 2: 180,464,799 V258A probably damaging Het
Sycp2l T G 13: 41,137,914 L256R probably damaging Het
Top2a C T 11: 99,014,741 V337I probably benign Het
Unc13a A C 8: 71,645,761 F1127V possibly damaging Het
Wdr25 C T 12: 109,026,467 Q435* probably null Het
Zc3h7b T G 15: 81,780,518 L526R probably damaging Het
Zcchc11 T C 4: 108,530,942 L1160P probably damaging Het
Zeb1 C A 18: 5,705,127 T48K possibly damaging Het
Zfhx2 A C 14: 55,065,786 S1580R probably benign Het
Zfhx3 A G 8: 108,856,917 I1139V possibly damaging Het
Zfp536 C A 7: 37,480,067 V1038L probably benign Het
Zfp759 T A 13: 67,138,883 V166E probably benign Het
Zfp985 A T 4: 147,583,426 K250N possibly damaging Het
Other mutations in H2-DMa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03286:H2-DMa APN 17 34137109 splice site probably null
R0422:H2-DMa UTSW 17 34137947 missense probably damaging 1.00
R0620:H2-DMa UTSW 17 34137960 missense probably damaging 0.96
R1240:H2-DMa UTSW 17 34138406 critical splice acceptor site probably null
R1483:H2-DMa UTSW 17 34135750 missense possibly damaging 0.61
R1656:H2-DMa UTSW 17 34138142 missense possibly damaging 0.92
R1657:H2-DMa UTSW 17 34137399 critical splice donor site probably null
R1696:H2-DMa UTSW 17 34138413 missense probably benign 0.44
R2884:H2-DMa UTSW 17 34137147 missense probably damaging 1.00
R2886:H2-DMa UTSW 17 34137147 missense probably damaging 1.00
R5024:H2-DMa UTSW 17 34138487 missense possibly damaging 0.77
R5236:H2-DMa UTSW 17 34137939 missense probably damaging 1.00
R5632:H2-DMa UTSW 17 34138001 missense probably benign 0.14
R6358:H2-DMa UTSW 17 34137984 missense probably damaging 1.00
R6423:H2-DMa UTSW 17 34137196 missense probably benign 0.05
R7033:H2-DMa UTSW 17 34136997 splice site probably null
R7387:H2-DMa UTSW 17 34138127 missense probably damaging 1.00
R8060:H2-DMa UTSW 17 34137285 missense probably benign 0.05
R8813:H2-DMa UTSW 17 34135760 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- CGGTCCTTCAAGGGGTGAAAAG -3'
(R):5'- CAAGTGGAGAATCCTGGCAC -3'

Sequencing Primer
(F):5'- GGTGGGGCCCTCTAATTTTAC -3'
(R):5'- TGGAGAATCCTGGCACACACTG -3'
Posted On 2020-10-20