Incidental Mutation 'R8505:Tnn'
ID 655506
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Name tenascin N
Synonyms Tnw, tenascin-W
MMRRC Submission
Accession Numbers

Genbank: NM_177839.3; Ensembl: ENSMUST00000039178

Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock # R8505 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 160085029-160153580 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 160146023 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 258 (D258G)
Ref Sequence ENSEMBL: ENSMUSP00000039452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
AlphaFold Q80Z71
Predicted Effect probably damaging
Transcript: ENSMUST00000039178
AA Change: D258G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: D258G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131919
AA Change: D258G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725
AA Change: D258G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,374,497 K289N probably damaging Het
Adamts5 C A 16: 85,900,056 S71I probably benign Het
Astn2 T C 4: 65,381,588 Y1308C unknown Het
Cfap54 A C 10: 92,978,993 M1326R probably benign Het
Chga A G 12: 102,561,745 E165G probably damaging Het
Corin T A 5: 72,435,407 I216F probably benign Het
D930048N14Rik GGG GGGG 11: 51,651,119 probably null Het
Hectd1 A T 12: 51,750,362 W2198R probably damaging Het
Hs3st3a1 T A 11: 64,520,788 M384K possibly damaging Het
Ifi207 GTT GT 1: 173,729,450 probably null Het
Ighv1-37 A T 12: 114,896,628 V15E probably benign Het
Kank4 G A 4: 98,785,676 probably benign Het
Mical2 C A 7: 112,319,800 T432N probably benign Het
Morn1 A C 4: 155,093,335 E201A unknown Het
Myo5c T A 9: 75,246,141 I103N probably damaging Het
Nelfe G A 17: 34,854,803 probably null Het
Neo1 C A 9: 58,913,283 V786L probably benign Het
Nrxn2 T A 19: 6,490,133 V821E probably damaging Het
Ppp2r3d A G 9: 124,439,084 F111S Het
Rapgef2 G A 3: 79,079,042 R1064* probably null Het
Rpusd2 A G 2: 119,038,526 I477V probably benign Het
Rrm2 A G 12: 24,709,385 I128V probably benign Het
Ryr3 A T 2: 112,675,870 V3469E probably damaging Het
Sowahb T A 5: 93,042,591 E756D possibly damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Stk35 C T 2: 129,801,729 A211V probably damaging Het
Ston1 A G 17: 88,635,589 H141R probably benign Het
Tcaf2 A G 6: 42,629,541 I493T probably benign Het
Them4 A T 3: 94,317,540 T75S probably benign Het
Tjp2 T C 19: 24,111,074 D723G probably null Het
Ttn A G 2: 76,915,435 I5090T probably benign Het
Ubr4 G A 4: 139,429,569 G1013S Het
Utp20 A G 10: 88,818,008 L250P probably benign Het
Vmn1r199 A G 13: 22,383,147 T204A probably benign Het
Zfp518b T C 5: 38,672,776 T629A probably benign Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 160125451 missense possibly damaging 0.65
IGL00433:Tnn APN 1 160098206 splice site probably benign
IGL00858:Tnn APN 1 160088392 critical splice donor site probably null
IGL00939:Tnn APN 1 160147530 missense probably damaging 1.00
IGL01569:Tnn APN 1 160120554 missense possibly damaging 0.51
IGL01591:Tnn APN 1 160125574 missense probably damaging 1.00
IGL01628:Tnn APN 1 160147602 missense possibly damaging 0.89
IGL01811:Tnn APN 1 160107135 missense probably damaging 1.00
IGL01813:Tnn APN 1 160088438 missense probably damaging 1.00
IGL02340:Tnn APN 1 160145205 missense probably benign 0.00
IGL02488:Tnn APN 1 160140593 missense probably benign 0.21
IGL02535:Tnn APN 1 160122652 splice site probably null
IGL02563:Tnn APN 1 160114553 missense probably damaging 1.00
IGL02572:Tnn APN 1 160086107 missense probably damaging 1.00
IGL02740:Tnn APN 1 160140777 splice site probably benign
IGL02818:Tnn APN 1 160116278 missense possibly damaging 0.86
IGL03284:Tnn APN 1 160125452 missense probably benign 0.01
1mM(1):Tnn UTSW 1 160097341 missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 160086077 missense possibly damaging 0.91
R0023:Tnn UTSW 1 160104928 missense probably benign 0.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0316:Tnn UTSW 1 160120567 missense possibly damaging 0.93
R0492:Tnn UTSW 1 160120757 missense probably damaging 0.99
R0547:Tnn UTSW 1 160116337 intron probably benign
R1067:Tnn UTSW 1 160125398 missense probably damaging 1.00
R1563:Tnn UTSW 1 160125415 missense probably damaging 1.00
R1565:Tnn UTSW 1 160097265 missense probably damaging 1.00
R1615:Tnn UTSW 1 160118408 missense possibly damaging 0.93
R1637:Tnn UTSW 1 160147600 missense probably damaging 1.00
R1707:Tnn UTSW 1 160145144 missense probably damaging 1.00
R1758:Tnn UTSW 1 160147584 missense possibly damaging 0.61
R1797:Tnn UTSW 1 160140688 missense probably damaging 1.00
R1847:Tnn UTSW 1 160116182 missense possibly damaging 0.51
R1925:Tnn UTSW 1 160097229 missense probably damaging 1.00
R2182:Tnn UTSW 1 160140600 splice site probably null
R2196:Tnn UTSW 1 160097228 nonsense probably null
R2225:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2227:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2286:Tnn UTSW 1 160110509 missense possibly damaging 0.89
R2850:Tnn UTSW 1 160139287 missense probably benign 0.00
R3110:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3111:Tnn UTSW 1 160107055 missense probably damaging 0.98
R3112:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3729:Tnn UTSW 1 160146240 missense probably damaging 1.00
R4183:Tnn UTSW 1 160097355 missense probably damaging 1.00
R4439:Tnn UTSW 1 160116080 missense probably benign
R4441:Tnn UTSW 1 160116080 missense probably benign
R4588:Tnn UTSW 1 160145111 missense probably benign 0.25
R4646:Tnn UTSW 1 160146042 missense probably benign
R4647:Tnn UTSW 1 160146042 missense probably benign
R4648:Tnn UTSW 1 160146042 missense probably benign
R4701:Tnn UTSW 1 160147768 missense possibly damaging 0.72
R4703:Tnn UTSW 1 160116245 missense possibly damaging 0.84
R4737:Tnn UTSW 1 160146089 missense probably damaging 1.00
R4801:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4802:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4868:Tnn UTSW 1 160130873 missense possibly damaging 0.64
R4977:Tnn UTSW 1 160120618 missense probably damaging 1.00
R5011:Tnn UTSW 1 160126379 missense possibly damaging 0.89
R5026:Tnn UTSW 1 160146137 missense probably benign 0.00
R5027:Tnn UTSW 1 160145211 missense probably damaging 1.00
R5049:Tnn UTSW 1 160140738 missense probably benign 0.00
R5119:Tnn UTSW 1 160120552 missense probably damaging 0.98
R5128:Tnn UTSW 1 160122894 missense probably damaging 0.98
R5234:Tnn UTSW 1 160144999 missense possibly damaging 0.95
R5398:Tnn UTSW 1 160147522 missense probably benign 0.00
R5424:Tnn UTSW 1 160122702 missense possibly damaging 0.69
R5452:Tnn UTSW 1 160110261 missense probably benign 0.13
R5466:Tnn UTSW 1 160120536 missense possibly damaging 0.93
R6022:Tnn UTSW 1 160110358 missense probably benign 0.00
R6062:Tnn UTSW 1 160098278 missense probably damaging 1.00
R6086:Tnn UTSW 1 160086120 missense probably damaging 1.00
R6132:Tnn UTSW 1 160146071 missense probably damaging 0.96
R6324:Tnn UTSW 1 160145204 missense probably damaging 0.96
R6455:Tnn UTSW 1 160114719 missense probably damaging 1.00
R6563:Tnn UTSW 1 160088398 missense probably damaging 1.00
R6650:Tnn UTSW 1 160114583 missense probably damaging 1.00
R6806:Tnn UTSW 1 160120708 missense possibly damaging 0.95
R6810:Tnn UTSW 1 160104842 missense probably damaging 1.00
R7157:Tnn UTSW 1 160126377 nonsense probably null
R7243:Tnn UTSW 1 160107117 missense probably benign 0.07
R7340:Tnn UTSW 1 160146022 missense probably damaging 0.98
R7472:Tnn UTSW 1 160110347 missense probably benign 0.12
R7502:Tnn UTSW 1 160110359 missense probably benign 0.00
R7527:Tnn UTSW 1 160118504 missense possibly damaging 0.51
R7608:Tnn UTSW 1 160088414 nonsense probably null
R7746:Tnn UTSW 1 160114685 missense probably damaging 0.97
R8096:Tnn UTSW 1 160122841 missense probably damaging 1.00
R8136:Tnn UTSW 1 160107060 missense probably damaging 0.96
R8191:Tnn UTSW 1 160125518 missense probably damaging 1.00
R8334:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8335:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8337:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8338:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8427:Tnn UTSW 1 160130686 missense probably damaging 0.99
R8433:Tnn UTSW 1 160097220 missense possibly damaging 0.81
R8479:Tnn UTSW 1 160122827 missense probably benign 0.06
R8554:Tnn UTSW 1 160110416 missense probably damaging 1.00
R8717:Tnn UTSW 1 160116276 missense possibly damaging 0.51
R8850:Tnn UTSW 1 160110244 critical splice donor site probably null
R8928:Tnn UTSW 1 160125529 missense probably damaging 1.00
R9209:Tnn UTSW 1 160126416 missense probably benign 0.02
X0019:Tnn UTSW 1 160086146 missense probably damaging 1.00
Z1176:Tnn UTSW 1 160146293 missense probably benign
Z1177:Tnn UTSW 1 160126527 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCATTCTATCAGAATCAGGACCA -3'
(R):5'- TGTGTGACGCGCCCTATGT -3'

Sequencing Primer
(F):5'- GCAGGAGACCCAGGACTTTATTC -3'
(R):5'- CCTATGTGGGGGTCGACTGC -3'
Posted On 2020-10-20