Incidental Mutation 'R8505:Stk35'
ID 655511
Institutional Source Beutler Lab
Gene Symbol Stk35
Ensembl Gene ENSMUSG00000037885
Gene Name serine/threonine kinase 35
Synonyms 1700054C12Rik, CLIK1, CLP-36 interacting kinase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8505 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 129800517-129832287 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 129801729 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 211 (A211V)
Ref Sequence ENSEMBL: ENSMUSP00000126541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165413] [ENSMUST00000166282]
AlphaFold Q80ZW0
Predicted Effect probably damaging
Transcript: ENSMUST00000165413
AA Change: A211V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126541
Gene: ENSMUSG00000037885
AA Change: A211V

DomainStartEndE-ValueType
low complexity region 51 69 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
Pfam:Pkinase_Tyr 207 295 2e-6 PFAM
Pfam:Pkinase 207 531 8.6e-51 PFAM
Pfam:Pkinase_Tyr 304 532 2.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166282
AA Change: A211V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132862
Gene: ENSMUSG00000037885
AA Change: A211V

DomainStartEndE-ValueType
low complexity region 51 69 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
Pfam:Pkinase_Tyr 207 300 5.9e-7 PFAM
Pfam:Pkinase 207 311 1e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinase that is predominantly found in the nucleus. However, it can interact with PDLIM1/CLP-36 in the cytoplasm and localize to actin stress fibers. The encoded protein may be a regulator of actin stress fibers in nonmuscle cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,374,497 K289N probably damaging Het
Adamts5 C A 16: 85,900,056 S71I probably benign Het
Astn2 T C 4: 65,381,588 Y1308C unknown Het
Cfap54 A C 10: 92,978,993 M1326R probably benign Het
Chga A G 12: 102,561,745 E165G probably damaging Het
Corin T A 5: 72,435,407 I216F probably benign Het
D930048N14Rik GGG GGGG 11: 51,651,119 probably null Het
Hectd1 A T 12: 51,750,362 W2198R probably damaging Het
Hs3st3a1 T A 11: 64,520,788 M384K possibly damaging Het
Ifi207 GTT GT 1: 173,729,450 probably null Het
Ighv1-37 A T 12: 114,896,628 V15E probably benign Het
Kank4 G A 4: 98,785,676 probably benign Het
Mical2 C A 7: 112,319,800 T432N probably benign Het
Morn1 A C 4: 155,093,335 E201A unknown Het
Myo5c T A 9: 75,246,141 I103N probably damaging Het
Nelfe G A 17: 34,854,803 probably null Het
Neo1 C A 9: 58,913,283 V786L probably benign Het
Nrxn2 T A 19: 6,490,133 V821E probably damaging Het
Ppp2r3d A G 9: 124,439,084 F111S Het
Rapgef2 G A 3: 79,079,042 R1064* probably null Het
Rpusd2 A G 2: 119,038,526 I477V probably benign Het
Rrm2 A G 12: 24,709,385 I128V probably benign Het
Ryr3 A T 2: 112,675,870 V3469E probably damaging Het
Sowahb T A 5: 93,042,591 E756D possibly damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Ston1 A G 17: 88,635,589 H141R probably benign Het
Tcaf2 A G 6: 42,629,541 I493T probably benign Het
Them4 A T 3: 94,317,540 T75S probably benign Het
Tjp2 T C 19: 24,111,074 D723G probably null Het
Tnn T C 1: 160,146,023 D258G probably damaging Het
Ttn A G 2: 76,915,435 I5090T probably benign Het
Ubr4 G A 4: 139,429,569 G1013S Het
Utp20 A G 10: 88,818,008 L250P probably benign Het
Vmn1r199 A G 13: 22,383,147 T204A probably benign Het
Zfp518b T C 5: 38,672,776 T629A probably benign Het
Other mutations in Stk35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Stk35 APN 2 129801992 missense probably damaging 1.00
IGL02609:Stk35 APN 2 129801801 missense probably damaging 1.00
fingernails UTSW 2 129810935 missense probably damaging 1.00
R2256_Stk35_331 UTSW 2 129810507 nonsense probably null
skinned UTSW 2 129811235 intron probably benign
R0045:Stk35 UTSW 2 129800568 nonsense probably null
R0306:Stk35 UTSW 2 129801763 nonsense probably null
R0784:Stk35 UTSW 2 129810802 nonsense probably null
R1536:Stk35 UTSW 2 129811235 intron probably benign
R2256:Stk35 UTSW 2 129810507 nonsense probably null
R2507:Stk35 UTSW 2 129801515 missense probably damaging 0.97
R2508:Stk35 UTSW 2 129801515 missense probably damaging 0.97
R3848:Stk35 UTSW 2 129800736 missense probably benign 0.13
R3872:Stk35 UTSW 2 129810575 missense possibly damaging 0.82
R4466:Stk35 UTSW 2 129801516 missense probably damaging 0.99
R5144:Stk35 UTSW 2 129810935 missense probably damaging 1.00
R6267:Stk35 UTSW 2 129810888 nonsense probably null
R6296:Stk35 UTSW 2 129810888 nonsense probably null
R6480:Stk35 UTSW 2 129810687 missense possibly damaging 0.95
R6807:Stk35 UTSW 2 129801653 missense probably damaging 0.97
R7203:Stk35 UTSW 2 129801593 missense probably benign
R7476:Stk35 UTSW 2 129810725 missense probably damaging 1.00
R8998:Stk35 UTSW 2 129810589 missense probably damaging 1.00
R8999:Stk35 UTSW 2 129810589 missense probably damaging 1.00
R9224:Stk35 UTSW 2 129810571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGATCACCATCCAAGGTCCC -3'
(R):5'- CTTGTTGCCGTGACTCATGC -3'

Sequencing Primer
(F):5'- TCCACATCTCGGGGCTAGAC -3'
(R):5'- TAACCCGTTGCGCTGTAG -3'
Posted On 2020-10-20