Incidental Mutation 'R8505:Them4'
ID 655513
Institutional Source Beutler Lab
Gene Symbol Them4
Ensembl Gene ENSMUSG00000028145
Gene Name thioesterase superfamily member 4
Synonyms 2700077M13Rik, 4921507I02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8505 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 94310089-94332540 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 94317540 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 75 (T75S)
Ref Sequence ENSEMBL: ENSMUSP00000062841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049822]
AlphaFold Q3UUI3
Predicted Effect probably benign
Transcript: ENSMUST00000049822
AA Change: T75S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000062841
Gene: ENSMUSG00000028145
AA Change: T75S

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
Pfam:4HBT 139 213 8.1e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase B (PKB) is a major downstream target of receptor tyrosine kinases that signal via phosphatidylinositol 3-kinase. Upon cell stimulation, PKB is translocated to the plasma membrane, where it is phosphorylated in the C-terminal regulatory domain. The protein encoded by this gene negatively regulates PKB activity by inhibiting phosphorylation. Transcription of this gene is commonly downregulated in glioblastomas. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit elongated mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,374,497 K289N probably damaging Het
Adamts5 C A 16: 85,900,056 S71I probably benign Het
Astn2 T C 4: 65,381,588 Y1308C unknown Het
Cfap54 A C 10: 92,978,993 M1326R probably benign Het
Chga A G 12: 102,561,745 E165G probably damaging Het
Corin T A 5: 72,435,407 I216F probably benign Het
D930048N14Rik GGG GGGG 11: 51,651,119 probably null Het
Hectd1 A T 12: 51,750,362 W2198R probably damaging Het
Hs3st3a1 T A 11: 64,520,788 M384K possibly damaging Het
Ifi207 GTT GT 1: 173,729,450 probably null Het
Ighv1-37 A T 12: 114,896,628 V15E probably benign Het
Kank4 G A 4: 98,785,676 probably benign Het
Mical2 C A 7: 112,319,800 T432N probably benign Het
Morn1 A C 4: 155,093,335 E201A unknown Het
Myo5c T A 9: 75,246,141 I103N probably damaging Het
Nelfe G A 17: 34,854,803 probably null Het
Neo1 C A 9: 58,913,283 V786L probably benign Het
Nrxn2 T A 19: 6,490,133 V821E probably damaging Het
Ppp2r3d A G 9: 124,439,084 F111S Het
Rapgef2 G A 3: 79,079,042 R1064* probably null Het
Rpusd2 A G 2: 119,038,526 I477V probably benign Het
Rrm2 A G 12: 24,709,385 I128V probably benign Het
Ryr3 A T 2: 112,675,870 V3469E probably damaging Het
Sowahb T A 5: 93,042,591 E756D possibly damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Stk35 C T 2: 129,801,729 A211V probably damaging Het
Ston1 A G 17: 88,635,589 H141R probably benign Het
Tcaf2 A G 6: 42,629,541 I493T probably benign Het
Tjp2 T C 19: 24,111,074 D723G probably null Het
Tnn T C 1: 160,146,023 D258G probably damaging Het
Ttn A G 2: 76,915,435 I5090T probably benign Het
Ubr4 G A 4: 139,429,569 G1013S Het
Utp20 A G 10: 88,818,008 L250P probably benign Het
Vmn1r199 A G 13: 22,383,147 T204A probably benign Het
Zfp518b T C 5: 38,672,776 T629A probably benign Het
Other mutations in Them4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02403:Them4 APN 3 94323671 missense probably damaging 1.00
R0135:Them4 UTSW 3 94323570 splice site probably benign
R0586:Them4 UTSW 3 94329794 missense possibly damaging 0.95
R4345:Them4 UTSW 3 94329865 missense possibly damaging 0.93
R4998:Them4 UTSW 3 94329781 missense probably damaging 1.00
R5214:Them4 UTSW 3 94317511 missense probably benign 0.13
R5649:Them4 UTSW 3 94331544 missense possibly damaging 0.62
R6041:Them4 UTSW 3 94317499 missense possibly damaging 0.93
R6814:Them4 UTSW 3 94324371 missense probably damaging 1.00
R6872:Them4 UTSW 3 94324371 missense probably damaging 1.00
R7611:Them4 UTSW 3 94331558 missense possibly damaging 0.96
R8815:Them4 UTSW 3 94324303 missense probably damaging 1.00
R9290:Them4 UTSW 3 94324323 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACAAATGAACTTAGGAACTTGC -3'
(R):5'- CCTTCCTCCCCATTCAGAAAGG -3'

Sequencing Primer
(F):5'- AAATACTACACATTTCCTATTCCTCG -3'
(R):5'- AGCCCATGGATTTGAACTTGC -3'
Posted On 2020-10-20