Incidental Mutation 'R8505:Sppl2b'
ID 655526
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Name signal peptide peptidase like 2B
Synonyms 3110056O03Rik
MMRRC Submission 067841-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # R8505 (G1)
Quality Score 217.468
Status Not validated
Chromosome 10
Chromosomal Location 80691109-80704542 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TGTCACAGGT to TGT at 80701903 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]
AlphaFold Q3TD49
Predicted Effect probably null
Transcript: ENSMUST00000035597
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218789
Predicted Effect probably benign
Transcript: ENSMUST00000219614
Predicted Effect probably null
Transcript: ENSMUST00000219951
Predicted Effect probably null
Transcript: ENSMUST00000220091
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,593,471 (GRCm39) K289N probably damaging Het
Adamts5 C A 16: 85,696,944 (GRCm39) S71I probably benign Het
Astn2 T C 4: 65,299,825 (GRCm39) Y1308C unknown Het
Cfap54 A C 10: 92,814,855 (GRCm39) M1326R probably benign Het
Chga A G 12: 102,528,004 (GRCm39) E165G probably damaging Het
Corin T A 5: 72,592,750 (GRCm39) I216F probably benign Het
D930048N14Rik GGG GGGG 11: 51,541,946 (GRCm39) probably null Het
Hectd1 A T 12: 51,797,145 (GRCm39) W2198R probably damaging Het
Hs3st3a1 T A 11: 64,411,614 (GRCm39) M384K possibly damaging Het
Ifi207 GTT GT 1: 173,557,016 (GRCm39) probably null Het
Ighv1-37 A T 12: 114,860,248 (GRCm39) V15E probably benign Het
Kank4 G A 4: 98,673,913 (GRCm39) probably benign Het
Mical2 C A 7: 111,919,007 (GRCm39) T432N probably benign Het
Morn1 A C 4: 155,177,792 (GRCm39) E201A unknown Het
Myo5c T A 9: 75,153,423 (GRCm39) I103N probably damaging Het
Nelfe G A 17: 35,073,779 (GRCm39) probably null Het
Neo1 C A 9: 58,820,566 (GRCm39) V786L probably benign Het
Nrxn2 T A 19: 6,540,163 (GRCm39) V821E probably damaging Het
Ppp2r3d A G 9: 124,439,084 (GRCm38) F111S Het
Rapgef2 G A 3: 78,986,349 (GRCm39) R1064* probably null Het
Rpusd2 A G 2: 118,869,007 (GRCm39) I477V probably benign Het
Rrm2 A G 12: 24,759,384 (GRCm39) I128V probably benign Het
Ryr3 A T 2: 112,506,215 (GRCm39) V3469E probably damaging Het
Sowahb T A 5: 93,190,450 (GRCm39) E756D possibly damaging Het
Stk35 C T 2: 129,643,649 (GRCm39) A211V probably damaging Het
Ston1 A G 17: 88,943,017 (GRCm39) H141R probably benign Het
Tcaf2 A G 6: 42,606,475 (GRCm39) I493T probably benign Het
Them4 A T 3: 94,224,847 (GRCm39) T75S probably benign Het
Tjp2 T C 19: 24,088,438 (GRCm39) D723G probably null Het
Tnn T C 1: 159,973,593 (GRCm39) D258G probably damaging Het
Ttn A G 2: 76,745,779 (GRCm39) I5090T probably benign Het
Ubr4 G A 4: 139,156,880 (GRCm39) G1013S Het
Utp20 A G 10: 88,653,870 (GRCm39) L250P probably benign Het
Vmn1r199 A G 13: 22,567,317 (GRCm39) T204A probably benign Het
Zfp518b T C 5: 38,830,119 (GRCm39) T629A probably benign Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80,699,928 (GRCm39) missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80,701,175 (GRCm39) missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80,697,220 (GRCm39) missense probably benign 0.00
IGL01964:Sppl2b APN 10 80,701,220 (GRCm39) critical splice donor site probably null
IGL02376:Sppl2b APN 10 80,703,432 (GRCm39) nonsense probably null
R1641:Sppl2b UTSW 10 80,700,965 (GRCm39) missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80,701,451 (GRCm39) missense probably damaging 1.00
R3104:Sppl2b UTSW 10 80,703,325 (GRCm39) missense probably benign 0.00
R3106:Sppl2b UTSW 10 80,703,325 (GRCm39) missense probably benign 0.00
R4350:Sppl2b UTSW 10 80,698,560 (GRCm39) missense probably benign 0.12
R5146:Sppl2b UTSW 10 80,703,474 (GRCm39) makesense probably null
R5698:Sppl2b UTSW 10 80,701,879 (GRCm39) splice site probably null
R6969:Sppl2b UTSW 10 80,700,959 (GRCm39) missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80,703,253 (GRCm39) missense probably benign 0.02
R8212:Sppl2b UTSW 10 80,701,193 (GRCm39) missense probably damaging 1.00
R8263:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8265:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8367:Sppl2b UTSW 10 80,699,025 (GRCm39) missense probably benign 0.02
R8398:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8398:Sppl2b UTSW 10 80,701,902 (GRCm39) frame shift probably null
R8400:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8480:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8481:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8817:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8818:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R8832:Sppl2b UTSW 10 80,701,903 (GRCm39) frame shift probably null
R9175:Sppl2b UTSW 10 80,698,807 (GRCm39) missense probably benign
R9624:Sppl2b UTSW 10 80,699,373 (GRCm39) missense probably benign 0.03
Z1176:Sppl2b UTSW 10 80,703,259 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TGTGCATGCCCATTGTCACC -3'
(R):5'- TGGGCCAGACACTCAACTAC -3'

Sequencing Primer
(F):5'- ATTGTCACCATCCACCTGGCAG -3'
(R):5'- GGGCCAGACACTCAACTACTCAAG -3'
Posted On 2020-10-20