Incidental Mutation 'R8505:Sppl2b'
ID655526
Institutional Source Beutler Lab
Gene Symbol Sppl2b
Ensembl Gene ENSMUSG00000035206
Gene Namesignal peptide peptidase like 2B
Synonyms3110056O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R8505 (G1)
Quality Score217.468
Status Not validated
Chromosome10
Chromosomal Location80855275-80868708 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TGTCACAGGT to TGT at 80866069 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035597] [ENSMUST00000220091]
Predicted Effect probably null
Transcript: ENSMUST00000035597
SMART Domains Protein: ENSMUSP00000036289
Gene: ENSMUSG00000035206

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:PA 55 147 5.5e-14 PFAM
transmembrane domain 167 189 N/A INTRINSIC
PSN 210 485 2.16e-113 SMART
low complexity region 520 531 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218789
Predicted Effect probably benign
Transcript: ENSMUST00000219614
Predicted Effect probably null
Transcript: ENSMUST00000219951
Predicted Effect probably null
Transcript: ENSMUST00000220091
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases. The GXGD proteases are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions. This enzyme localizes to endosomes, lysosomes, and the plasma membrane. It cleaves the transmembrane domain of tumor necrosis factor alpha to release the intracellular domain, which triggers cytokine expression in the innate and adaptive immunity pathways. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal with no apparent defects in B cell and dendritic cell homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,374,497 K289N probably damaging Het
Adamts5 C A 16: 85,900,056 S71I probably benign Het
Astn2 T C 4: 65,381,588 Y1308C unknown Het
Cfap54 A C 10: 92,978,993 M1326R probably benign Het
Chga A G 12: 102,561,745 E165G probably damaging Het
Corin T A 5: 72,435,407 I216F probably benign Het
D930048N14Rik GGG GGGG 11: 51,651,119 probably null Het
Hectd1 A T 12: 51,750,362 W2198R probably damaging Het
Hs3st3a1 T A 11: 64,520,788 M384K possibly damaging Het
Ifi207 GTT GT 1: 173,729,450 probably null Het
Ighv1-37 A T 12: 114,896,628 V15E probably benign Het
Kank4 G A 4: 98,785,676 probably benign Het
Mical2 C A 7: 112,319,800 T432N probably benign Het
Morn1 A C 4: 155,093,335 E201A unknown Het
Myo5c T A 9: 75,246,141 I103N probably damaging Het
Nelfe G A 17: 34,854,803 probably null Het
Neo1 C A 9: 58,913,283 V786L probably benign Het
Nrxn2 T A 19: 6,490,133 V821E probably damaging Het
Ppp2r3d A G 9: 124,439,084 F111S Het
Rapgef2 G A 3: 79,079,042 R1064* probably null Het
Rpusd2 A G 2: 119,038,526 I477V probably benign Het
Rrm2 A G 12: 24,709,385 I128V probably benign Het
Ryr3 A T 2: 112,675,870 V3469E probably damaging Het
Sowahb T A 5: 93,042,591 E756D possibly damaging Het
Stk35 C T 2: 129,801,729 A211V probably damaging Het
Ston1 A G 17: 88,635,589 H141R probably benign Het
Tcaf2 A G 6: 42,629,541 I493T probably benign Het
Them4 A T 3: 94,317,540 T75S probably benign Het
Tjp2 T C 19: 24,111,074 D723G probably null Het
Tnn T C 1: 160,146,023 D258G probably damaging Het
Ttn A G 2: 76,915,435 I5090T probably benign Het
Ubr4 G A 4: 139,429,569 G1013S Het
Utp20 A G 10: 88,818,008 L250P probably benign Het
Vmn1r199 A G 13: 22,383,147 T204A probably benign Het
Zfp518b T C 5: 38,672,776 T629A probably benign Het
Other mutations in Sppl2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Sppl2b APN 10 80864094 missense probably damaging 1.00
IGL01835:Sppl2b APN 10 80865341 missense probably damaging 0.99
IGL01836:Sppl2b APN 10 80861386 missense probably benign 0.00
IGL01964:Sppl2b APN 10 80865386 critical splice donor site probably null
IGL02376:Sppl2b APN 10 80867598 nonsense probably null
R1641:Sppl2b UTSW 10 80865131 missense probably damaging 0.96
R2228:Sppl2b UTSW 10 80865617 missense probably damaging 1.00
R3104:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R3106:Sppl2b UTSW 10 80867491 missense probably benign 0.00
R4350:Sppl2b UTSW 10 80862726 missense probably benign 0.12
R5146:Sppl2b UTSW 10 80867640 makesense probably null
R5698:Sppl2b UTSW 10 80866045 splice site probably null
R6969:Sppl2b UTSW 10 80865125 missense probably damaging 1.00
R7649:Sppl2b UTSW 10 80867419 missense probably benign 0.02
R8212:Sppl2b UTSW 10 80865359 missense probably damaging 1.00
R8263:Sppl2b UTSW 10 80866069 frame shift probably null
R8265:Sppl2b UTSW 10 80866069 frame shift probably null
R8367:Sppl2b UTSW 10 80863191 missense probably benign 0.02
R8398:Sppl2b UTSW 10 80866068 frame shift probably null
R8398:Sppl2b UTSW 10 80866069 frame shift probably null
R8400:Sppl2b UTSW 10 80866069 frame shift probably null
R8480:Sppl2b UTSW 10 80866069 frame shift probably null
R8481:Sppl2b UTSW 10 80866069 frame shift probably null
R8817:Sppl2b UTSW 10 80866069 frame shift probably null
R8818:Sppl2b UTSW 10 80866069 frame shift probably null
R8832:Sppl2b UTSW 10 80866069 frame shift probably null
Z1176:Sppl2b UTSW 10 80867425 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TGTGCATGCCCATTGTCACC -3'
(R):5'- TGGGCCAGACACTCAACTAC -3'

Sequencing Primer
(F):5'- ATTGTCACCATCCACCTGGCAG -3'
(R):5'- GGGCCAGACACTCAACTACTCAAG -3'
Posted On2020-10-20