Incidental Mutation 'R8505:Rrm2'
ID 655531
Institutional Source Beutler Lab
Gene Symbol Rrm2
Ensembl Gene ENSMUSG00000020649
Gene Name ribonucleotide reductase M2
Synonyms R2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8505 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 24708241-24714146 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24709385 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 128 (I128V)
Ref Sequence ENSEMBL: ENSMUSP00000020980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020980] [ENSMUST00000153058] [ENSMUST00000154588]
AlphaFold P11157
PDB Structure SMALL SUBUNIT C-TERMINAL INHIBITORY PEPTIDE OF MOUSE RIBONUCLEOTIDE REDUCTASE AS BOUND TO THE LARGE SUBUNIT, NMR, 26 STRUCTURES [SOLUTION NMR]
COBALT SUBSTITUTION OF MOUSE R2 RIBONUCLEOTIDE REDUCTASE TO MODEL THE REACTIVE DIFERROUS STATE [X-RAY DIFFRACTION]
COBALT SUBSTITUTION OF MOUSE R2 RIBONUCLEOTIDE REDUCTASE TO MODEL THE REACTIVE DIFERROUS STATE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE RIBONUCLEOTIDE REDUCTASE SUBUNIT R2 UNDER OXIDIZING CONDITIONS. A FULLY OCCUPIED DINUCLEAR IRON CLUSTER. [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE RIBONUCLEOTIDE REDUCTASE SUBUNIT R2 UNDER REDUCING CONDITIONS. A FULLY OCCUPIED DINUCLEAR IRON CLUSTER AND BOUND ACETATE. [X-RAY DIFFRACTION]
PROTEIN R2 OF RIBONUCLEOTIDE REDUCTASE FROM MOUSE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020980
AA Change: I128V

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020980
Gene: ENSMUSG00000020649
AA Change: I128V

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 80 347 1.6e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153058
AA Change: I97V

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120893
Gene: ENSMUSG00000020649
AA Change: I97V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Ribonuc_red_sm 40 225 2.6e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154588
AA Change: I40V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000119502
Gene: ENSMUSG00000020649
AA Change: I40V

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 1 181 2.7e-88 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two non-identical subunits for ribonucleotide reductase. This reductase catalyzes the formation of deoxyribonucleotides from ribonucleotides. Synthesis of the encoded protein (M2) is regulated in a cell-cycle dependent fashion. Transcription from this gene can initiate from alternative promoters, which results in two isoforms that differ in the lengths of their N-termini. Related pseudogenes have been identified on chromosomes 1 and X. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A T 17: 24,374,497 K289N probably damaging Het
Adamts5 C A 16: 85,900,056 S71I probably benign Het
Astn2 T C 4: 65,381,588 Y1308C unknown Het
Cfap54 A C 10: 92,978,993 M1326R probably benign Het
Chga A G 12: 102,561,745 E165G probably damaging Het
Corin T A 5: 72,435,407 I216F probably benign Het
D930048N14Rik GGG GGGG 11: 51,651,119 probably null Het
Hectd1 A T 12: 51,750,362 W2198R probably damaging Het
Hs3st3a1 T A 11: 64,520,788 M384K possibly damaging Het
Ifi207 GTT GT 1: 173,729,450 probably null Het
Ighv1-37 A T 12: 114,896,628 V15E probably benign Het
Kank4 G A 4: 98,785,676 probably benign Het
Mical2 C A 7: 112,319,800 T432N probably benign Het
Morn1 A C 4: 155,093,335 E201A unknown Het
Myo5c T A 9: 75,246,141 I103N probably damaging Het
Nelfe G A 17: 34,854,803 probably null Het
Neo1 C A 9: 58,913,283 V786L probably benign Het
Nrxn2 T A 19: 6,490,133 V821E probably damaging Het
Ppp2r3d A G 9: 124,439,084 F111S Het
Rapgef2 G A 3: 79,079,042 R1064* probably null Het
Rpusd2 A G 2: 119,038,526 I477V probably benign Het
Ryr3 A T 2: 112,675,870 V3469E probably damaging Het
Sowahb T A 5: 93,042,591 E756D possibly damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Stk35 C T 2: 129,801,729 A211V probably damaging Het
Ston1 A G 17: 88,635,589 H141R probably benign Het
Tcaf2 A G 6: 42,629,541 I493T probably benign Het
Them4 A T 3: 94,317,540 T75S probably benign Het
Tjp2 T C 19: 24,111,074 D723G probably null Het
Tnn T C 1: 160,146,023 D258G probably damaging Het
Ttn A G 2: 76,915,435 I5090T probably benign Het
Ubr4 G A 4: 139,429,569 G1013S Het
Utp20 A G 10: 88,818,008 L250P probably benign Het
Vmn1r199 A G 13: 22,383,147 T204A probably benign Het
Zfp518b T C 5: 38,672,776 T629A probably benign Het
Other mutations in Rrm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02354:Rrm2 APN 12 24711439 splice site probably benign
IGL02361:Rrm2 APN 12 24711439 splice site probably benign
IGL02957:Rrm2 APN 12 24708441 missense probably damaging 0.99
R1804:Rrm2 UTSW 12 24708612 missense probably benign 0.42
R1854:Rrm2 UTSW 12 24713152 missense probably damaging 1.00
R3826:Rrm2 UTSW 12 24708599 missense probably benign
R3827:Rrm2 UTSW 12 24708599 missense probably benign
R3828:Rrm2 UTSW 12 24708599 missense probably benign
R3830:Rrm2 UTSW 12 24708599 missense probably benign
R3851:Rrm2 UTSW 12 24708599 missense probably benign
R3938:Rrm2 UTSW 12 24709432 missense probably damaging 1.00
R4042:Rrm2 UTSW 12 24711451 missense probably benign 0.00
R4192:Rrm2 UTSW 12 24708378 missense probably benign 0.04
R5274:Rrm2 UTSW 12 24710407 nonsense probably null
R8375:Rrm2 UTSW 12 24712752 missense probably damaging 1.00
R8410:Rrm2 UTSW 12 24708623 missense probably benign
R8815:Rrm2 UTSW 12 24710471 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCACTGAGATATTGGGTGTTCC -3'
(R):5'- GTGTGTTAACCAGAGCGGAG -3'

Sequencing Primer
(F):5'- TAATGGATGTGAAGAATTCGGTAATG -3'
(R):5'- CAGAGCGGAGACTGGAGTC -3'
Posted On 2020-10-20