Incidental Mutation 'R8506:Fga'
ID655553
Institutional Source Beutler Lab
Gene Symbol Fga
Ensembl Gene ENSMUSG00000028001
Gene Namefibrinogen alpha chain
SynonymsENSMUSG00000059807, Fib
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R8506 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location83026076-83033627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83033316 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 759 (E759G)
Ref Sequence ENSEMBL: ENSMUSP00000133117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]
Predicted Effect probably benign
Transcript: ENSMUST00000029630
SMART Domains Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 458 1.6e-33 PFAM
low complexity region 500 522 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166581
AA Change: E759G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: E759G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 457 9.3e-34 PFAM
low complexity region 500 522 N/A INTRINSIC
FBG 550 786 1.43e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik A T 9: 101,942,972 E197V possibly damaging Het
Alkbh8 C T 9: 3,335,616 probably benign Het
Ank1 G A 8: 23,096,835 A498T probably damaging Het
Antxr1 T A 6: 87,188,173 E427D possibly damaging Het
App A C 16: 85,082,816 V143G unknown Het
Bod1l C A 5: 41,819,055 E1639* probably null Het
C2cd2 T C 16: 97,875,421 D122G Het
Ccdc88b G T 19: 6,847,322 P1357T probably damaging Het
Ccnyl1 A G 1: 64,714,662 T211A possibly damaging Het
Cdc25a T C 9: 109,891,752 Y434H probably damaging Het
Ceacam16 C A 7: 19,852,270 A106S unknown Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Chpf2 T C 5: 24,588,297 L87P probably damaging Het
Col5a2 A T 1: 45,442,784 I60N unknown Het
Cux1 T A 5: 136,308,504 E718V probably damaging Het
Dchs2 A T 3: 83,301,174 I1845L probably benign Het
Disp3 C T 4: 148,241,570 V1244I possibly damaging Het
Dnah8 T C 17: 30,721,134 S1685P probably benign Het
Etnppl G A 3: 130,629,473 V274I possibly damaging Het
Evc2 T C 5: 37,383,142 S561P probably damaging Het
Gdpd5 T C 7: 99,453,950 F372S probably benign Het
Gpr155 T C 2: 73,343,462 T868A probably damaging Het
Herc1 A G 9: 66,473,581 D3580G possibly damaging Het
Hmbs A G 9: 44,341,624 probably null Het
Ibsp A T 5: 104,310,081 E161D probably damaging Het
Ighv8-4 A G 12: 115,024,108 V90A possibly damaging Het
Itpr2 A G 6: 146,418,416 probably null Het
Kcnc2 T A 10: 112,455,632 F242I probably damaging Het
Kcnj5 A G 9: 32,322,332 I229T probably damaging Het
Lamb1 A T 12: 31,329,361 L1791F probably damaging Het
Med6 A T 12: 81,594,960 M1K probably null Het
Mei4 A G 9: 81,979,238 D294G probably benign Het
Nat10 T C 2: 103,732,237 I585V probably benign Het
Nid1 T C 13: 13,476,174 V432A probably damaging Het
Nlrp4c G T 7: 6,100,776 G903V possibly damaging Het
Nrf1 G A 6: 30,126,257 A416T probably benign Het
Nsl1 G C 1: 191,076,635 C173S unknown Het
Obsl1 G A 1: 75,505,656 A190V probably benign Het
Olfr1047 A G 2: 86,228,578 L131P possibly damaging Het
Olfr1085 T C 2: 86,658,401 D19G probably benign Het
Olfr1151 A T 2: 87,857,837 I221F probably damaging Het
Olfr1469 A G 19: 13,411,240 T224A possibly damaging Het
Olfr535 G A 7: 140,493,423 V262I probably benign Het
Olfr583 T A 7: 103,051,502 M68K probably damaging Het
Osbpl1a G A 18: 12,768,586 T621I probably benign Het
Pabpc4l G A 3: 46,446,397 R271* probably null Het
Paics A T 5: 76,964,590 D307V possibly damaging Het
Pcdhga9 A G 18: 37,738,684 D522G probably damaging Het
Pclo T A 5: 14,540,745 C1020S unknown Het
Pfkfb4 T G 9: 109,005,599 D113E possibly damaging Het
Plod3 A G 5: 136,988,976 Y202C probably damaging Het
Pmp22 T A 11: 63,158,264 M111K probably damaging Het
Pole2 A C 12: 69,208,960 S344A probably benign Het
Pom121l2 A G 13: 21,983,619 T687A probably benign Het
Psmd6 A G 14: 14,114,181 S313P probably damaging Het
Rd3 T G 1: 191,983,267 M1R probably null Het
Rtn4ip1 G A 10: 43,928,356 V235I probably benign Het
Senp5 T C 16: 31,968,901 I635V probably damaging Het
Stox2 T C 8: 47,192,073 E784G possibly damaging Het
Syce2 A T 8: 84,887,166 D168V probably benign Het
Taar6 A G 10: 23,985,631 S6P probably benign Het
Tbc1d16 A C 11: 119,148,958 H675Q probably damaging Het
Tmem151b A T 17: 45,545,401 I371N probably damaging Het
Trim31 A T 17: 36,907,258 probably null Het
Usp48 A G 4: 137,610,718 Y268C probably damaging Het
Vmn2r11 A G 5: 109,059,404 S17P probably benign Het
Vmn2r110 T A 17: 20,584,365 N98Y probably benign Het
Vps13b T A 15: 35,446,745 D515E probably benign Het
Yeats2 T G 16: 20,152,934 I42M probably damaging Het
Other mutations in Fga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Fga APN 3 83031674 missense probably damaging 1.00
IGL00478:Fga APN 3 83028644 missense probably benign 0.00
IGL00587:Fga APN 3 83030289 missense possibly damaging 0.62
IGL01289:Fga APN 3 83031245 missense possibly damaging 0.85
IGL01323:Fga APN 3 83030211 missense probably damaging 0.99
IGL01369:Fga APN 3 83030200 missense probably benign 0.00
IGL01409:Fga APN 3 83032752 missense probably damaging 1.00
IGL01541:Fga APN 3 83032707 missense probably damaging 1.00
IGL01633:Fga APN 3 83030299 missense possibly damaging 0.89
IGL01966:Fga APN 3 83029154 missense probably damaging 0.97
IGL02651:Fga APN 3 83028534 missense probably benign 0.00
IGL02822:Fga APN 3 83031482 missense probably damaging 1.00
IGL03003:Fga APN 3 83032730 missense probably damaging 1.00
R0336:Fga UTSW 3 83030857 missense probably damaging 1.00
R0540:Fga UTSW 3 83028562 missense probably damaging 1.00
R0607:Fga UTSW 3 83028562 missense probably damaging 1.00
R1471:Fga UTSW 3 83028618 missense probably benign 0.16
R1517:Fga UTSW 3 83031838 missense probably benign 0.00
R1817:Fga UTSW 3 83031775 missense probably benign 0.00
R1874:Fga UTSW 3 83032721 missense probably damaging 1.00
R2014:Fga UTSW 3 83032757 missense probably damaging 0.99
R2267:Fga UTSW 3 83032950 missense probably damaging 1.00
R2332:Fga UTSW 3 83031397 missense probably damaging 1.00
R2420:Fga UTSW 3 83033154 missense possibly damaging 0.53
R2443:Fga UTSW 3 83028541 missense probably benign 0.03
R3978:Fga UTSW 3 83030183 critical splice acceptor site probably null
R4597:Fga UTSW 3 83031235 nonsense probably null
R4644:Fga UTSW 3 83030266 missense possibly damaging 0.81
R4760:Fga UTSW 3 83031514 missense probably benign
R4867:Fga UTSW 3 83028644 missense probably benign 0.00
R5449:Fga UTSW 3 83030862 frame shift probably null
R5507:Fga UTSW 3 83033336 missense probably damaging 1.00
R5712:Fga UTSW 3 83033133 missense possibly damaging 0.70
R6853:Fga UTSW 3 83030912 missense probably damaging 1.00
R6865:Fga UTSW 3 83031541 missense probably damaging 1.00
R7163:Fga UTSW 3 83026264 missense probably benign 0.04
R7724:Fga UTSW 3 83029125 missense probably damaging 0.99
R8153:Fga UTSW 3 83030857 missense probably damaging 1.00
R8511:Fga UTSW 3 83031757 nonsense probably null
X0062:Fga UTSW 3 83030271 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCTTATGCGGAGTACCACTTC -3'
(R):5'- AGATCCGTGACACCTTCATC -3'

Sequencing Primer
(F):5'- CACTGCTGGAGATGCTCTG -3'
(R):5'- ATCCGTGACACCTTCATCTTCCG -3'
Posted On2020-10-20