Incidental Mutation 'R8506:Taar6'
ID655586
Institutional Source Beutler Lab
Gene Symbol Taar6
Ensembl Gene ENSMUSG00000045111
Gene Nametrace amine-associated receptor 6
SynonymsLOC215855
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R8506 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location23984609-23985646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23985631 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 6 (S6P)
Ref Sequence ENSEMBL: ENSMUSP00000097603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057080]
Predicted Effect probably benign
Transcript: ENSMUST00000057080
AA Change: S6P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000097603
Gene: ENSMUSG00000045111
AA Change: S6P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 326 5.5e-13 PFAM
Pfam:7tm_1 49 311 5.9e-58 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-transmembrane G-protein-coupled receptor that likely functions as a receptor for endogenous trace amines. Mutations in this gene may be associated with schizophrenia.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik A T 9: 101,942,972 E197V possibly damaging Het
Alkbh8 C T 9: 3,335,616 probably benign Het
Ank1 G A 8: 23,096,835 A498T probably damaging Het
Antxr1 T A 6: 87,188,173 E427D possibly damaging Het
App A C 16: 85,082,816 V143G unknown Het
Bod1l C A 5: 41,819,055 E1639* probably null Het
C2cd2 T C 16: 97,875,421 D122G Het
Ccdc88b G T 19: 6,847,322 P1357T probably damaging Het
Ccnyl1 A G 1: 64,714,662 T211A possibly damaging Het
Cdc25a T C 9: 109,891,752 Y434H probably damaging Het
Ceacam16 C A 7: 19,852,270 A106S unknown Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Chpf2 T C 5: 24,588,297 L87P probably damaging Het
Col5a2 A T 1: 45,442,784 I60N unknown Het
Cux1 T A 5: 136,308,504 E718V probably damaging Het
Dchs2 A T 3: 83,301,174 I1845L probably benign Het
Disp3 C T 4: 148,241,570 V1244I possibly damaging Het
Dnah8 T C 17: 30,721,134 S1685P probably benign Het
Etnppl G A 3: 130,629,473 V274I possibly damaging Het
Evc2 T C 5: 37,383,142 S561P probably damaging Het
Fga A G 3: 83,033,316 E759G probably damaging Het
Gdpd5 T C 7: 99,453,950 F372S probably benign Het
Gpr155 T C 2: 73,343,462 T868A probably damaging Het
Herc1 A G 9: 66,473,581 D3580G possibly damaging Het
Hmbs A G 9: 44,341,624 probably null Het
Ibsp A T 5: 104,310,081 E161D probably damaging Het
Ighv8-4 A G 12: 115,024,108 V90A possibly damaging Het
Itpr2 A G 6: 146,418,416 probably null Het
Kcnc2 T A 10: 112,455,632 F242I probably damaging Het
Kcnj5 A G 9: 32,322,332 I229T probably damaging Het
Lamb1 A T 12: 31,329,361 L1791F probably damaging Het
Med6 A T 12: 81,594,960 M1K probably null Het
Mei4 A G 9: 81,979,238 D294G probably benign Het
Nat10 T C 2: 103,732,237 I585V probably benign Het
Nid1 T C 13: 13,476,174 V432A probably damaging Het
Nlrp4c G T 7: 6,100,776 G903V possibly damaging Het
Nrf1 G A 6: 30,126,257 A416T probably benign Het
Nsl1 G C 1: 191,076,635 C173S unknown Het
Obsl1 G A 1: 75,505,656 A190V probably benign Het
Olfr1047 A G 2: 86,228,578 L131P possibly damaging Het
Olfr1085 T C 2: 86,658,401 D19G probably benign Het
Olfr1151 A T 2: 87,857,837 I221F probably damaging Het
Olfr1469 A G 19: 13,411,240 T224A possibly damaging Het
Olfr535 G A 7: 140,493,423 V262I probably benign Het
Olfr583 T A 7: 103,051,502 M68K probably damaging Het
Osbpl1a G A 18: 12,768,586 T621I probably benign Het
Pabpc4l G A 3: 46,446,397 R271* probably null Het
Paics A T 5: 76,964,590 D307V possibly damaging Het
Pcdhga9 A G 18: 37,738,684 D522G probably damaging Het
Pclo T A 5: 14,540,745 C1020S unknown Het
Pfkfb4 T G 9: 109,005,599 D113E possibly damaging Het
Plod3 A G 5: 136,988,976 Y202C probably damaging Het
Pmp22 T A 11: 63,158,264 M111K probably damaging Het
Pole2 A C 12: 69,208,960 S344A probably benign Het
Pom121l2 A G 13: 21,983,619 T687A probably benign Het
Psmd6 A G 14: 14,114,181 S313P probably damaging Het
Rd3 T G 1: 191,983,267 M1R probably null Het
Rtn4ip1 G A 10: 43,928,356 V235I probably benign Het
Senp5 T C 16: 31,968,901 I635V probably damaging Het
Stox2 T C 8: 47,192,073 E784G possibly damaging Het
Syce2 A T 8: 84,887,166 D168V probably benign Het
Tbc1d16 A C 11: 119,148,958 H675Q probably damaging Het
Tmem151b A T 17: 45,545,401 I371N probably damaging Het
Trim31 A T 17: 36,907,258 probably null Het
Usp48 A G 4: 137,610,718 Y268C probably damaging Het
Vmn2r11 A G 5: 109,059,404 S17P probably benign Het
Vmn2r110 T A 17: 20,584,365 N98Y probably benign Het
Vps13b T A 15: 35,446,745 D515E probably benign Het
Yeats2 T G 16: 20,152,934 I42M probably damaging Het
Other mutations in Taar6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Taar6 APN 10 23985508 missense probably benign 0.15
IGL00918:Taar6 APN 10 23985582 missense probably damaging 1.00
IGL01060:Taar6 APN 10 23985072 missense probably benign
IGL02608:Taar6 APN 10 23985183 missense probably benign 0.01
R0042:Taar6 UTSW 10 23985123 missense probably benign 0.36
R0042:Taar6 UTSW 10 23985123 missense probably benign 0.36
R0360:Taar6 UTSW 10 23985148 missense probably benign 0.01
R0364:Taar6 UTSW 10 23985148 missense probably benign 0.01
R0746:Taar6 UTSW 10 23985360 missense probably benign 0.43
R1637:Taar6 UTSW 10 23985181 missense probably benign 0.12
R4893:Taar6 UTSW 10 23985400 missense probably benign
R4944:Taar6 UTSW 10 23984715 missense probably damaging 1.00
R4951:Taar6 UTSW 10 23985208 missense probably benign 0.09
R5173:Taar6 UTSW 10 23985352 missense probably damaging 1.00
R5181:Taar6 UTSW 10 23984785 missense possibly damaging 0.76
R5919:Taar6 UTSW 10 23985270 missense probably damaging 1.00
R5988:Taar6 UTSW 10 23985256 missense probably damaging 0.98
R6327:Taar6 UTSW 10 23985279 missense probably damaging 1.00
R6493:Taar6 UTSW 10 23985123 missense probably benign 0.36
R7595:Taar6 UTSW 10 23985070 missense probably benign
R7802:Taar6 UTSW 10 23985253 missense probably benign 0.02
R8053:Taar6 UTSW 10 23985246 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TGCAGCTGCTTGAAATGGAG -3'
(R):5'- TGGACCATAGGAGCATTTATTGG -3'

Sequencing Primer
(F):5'- CTGCTTGAAATGGAGGATGGATATC -3'
(R):5'- TGGACCTCTTCTCCTTACAG -3'
Posted On2020-10-20