Incidental Mutation 'R8506:Pole2'
ID 655592
Institutional Source Beutler Lab
Gene Symbol Pole2
Ensembl Gene ENSMUSG00000020974
Gene Name polymerase (DNA directed), epsilon 2 (p59 subunit)
Synonyms DNA polymerase epsilon small subunit
MMRRC Submission 067842-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8506 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 69248547-69274969 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 69255734 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 344 (S344A)
Ref Sequence ENSEMBL: ENSMUSP00000021359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021359] [ENSMUST00000221411] [ENSMUST00000222699]
AlphaFold O54956
Predicted Effect probably benign
Transcript: ENSMUST00000021359
AA Change: S344A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021359
Gene: ENSMUSG00000020974
AA Change: S344A

DomainStartEndE-ValueType
Pfam:Dpoe2NT 2 74 1.9e-32 PFAM
Pfam:DNA_pol_E_B 287 489 1.4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221411
AA Change: S344A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222699
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA polymerase epsilon, which is involved in DNA repair and replication, is composed of a large catalytic subunit and a small accessory subunit. The protein encoded by this gene represents the small subunit (B). Defects in this gene have been linked to colorectal cancer and to combined immunodeficiency. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik A T 9: 101,820,171 (GRCm39) E197V possibly damaging Het
Alkbh8 C T 9: 3,335,616 (GRCm39) probably benign Het
Ank1 G A 8: 23,586,851 (GRCm39) A498T probably damaging Het
Antxr1 T A 6: 87,165,155 (GRCm39) E427D possibly damaging Het
App A C 16: 84,879,704 (GRCm39) V143G unknown Het
Bod1l C A 5: 41,976,398 (GRCm39) E1639* probably null Het
C2cd2 T C 16: 97,676,621 (GRCm39) D122G Het
Ccdc88b G T 19: 6,824,690 (GRCm39) P1357T probably damaging Het
Ccnyl1 A G 1: 64,753,821 (GRCm39) T211A possibly damaging Het
Cdc25a T C 9: 109,720,820 (GRCm39) Y434H probably damaging Het
Ceacam16 C A 7: 19,586,195 (GRCm39) A106S unknown Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Chpf2 T C 5: 24,793,295 (GRCm39) L87P probably damaging Het
Col5a2 A T 1: 45,481,944 (GRCm39) I60N unknown Het
Cux1 T A 5: 136,337,358 (GRCm39) E718V probably damaging Het
Dchs2 A T 3: 83,208,481 (GRCm39) I1845L probably benign Het
Disp3 C T 4: 148,326,027 (GRCm39) V1244I possibly damaging Het
Dnah8 T C 17: 30,940,108 (GRCm39) S1685P probably benign Het
Etnppl G A 3: 130,423,122 (GRCm39) V274I possibly damaging Het
Evc2 T C 5: 37,540,486 (GRCm39) S561P probably damaging Het
Fga A G 3: 82,940,623 (GRCm39) E759G probably damaging Het
Gdpd5 T C 7: 99,103,157 (GRCm39) F372S probably benign Het
Gpr155 T C 2: 73,173,806 (GRCm39) T868A probably damaging Het
Herc1 A G 9: 66,380,863 (GRCm39) D3580G possibly damaging Het
Hmbs A G 9: 44,252,921 (GRCm39) probably null Het
Ibsp A T 5: 104,457,947 (GRCm39) E161D probably damaging Het
Ighv8-4 A G 12: 114,987,728 (GRCm39) V90A possibly damaging Het
Itpr2 A G 6: 146,319,914 (GRCm39) probably null Het
Kcnc2 T A 10: 112,291,537 (GRCm39) F242I probably damaging Het
Kcnj5 A G 9: 32,233,628 (GRCm39) I229T probably damaging Het
Lamb1 A T 12: 31,379,360 (GRCm39) L1791F probably damaging Het
Med6 A T 12: 81,641,734 (GRCm39) M1K probably null Het
Mei4 A G 9: 81,861,291 (GRCm39) D294G probably benign Het
Nat10 T C 2: 103,562,582 (GRCm39) I585V probably benign Het
Nid1 T C 13: 13,650,759 (GRCm39) V432A probably damaging Het
Nlrp4c G T 7: 6,103,775 (GRCm39) G903V possibly damaging Het
Nrf1 G A 6: 30,126,256 (GRCm39) A416T probably benign Het
Nsl1 G C 1: 190,808,832 (GRCm39) C173S unknown Het
Obsl1 G A 1: 75,482,300 (GRCm39) A190V probably benign Het
Or13a22 G A 7: 140,073,336 (GRCm39) V262I probably benign Het
Or51f1d T A 7: 102,700,709 (GRCm39) M68K probably damaging Het
Or5b3 A G 19: 13,388,604 (GRCm39) T224A possibly damaging Het
Or5w8 A T 2: 87,688,181 (GRCm39) I221F probably damaging Het
Or8k3 A G 2: 86,058,922 (GRCm39) L131P possibly damaging Het
Or8k38 T C 2: 86,488,745 (GRCm39) D19G probably benign Het
Osbpl1a G A 18: 12,901,643 (GRCm39) T621I probably benign Het
Pabpc4l G A 3: 46,400,832 (GRCm39) R271* probably null Het
Paics A T 5: 77,112,437 (GRCm39) D307V possibly damaging Het
Pcdhga9 A G 18: 37,871,737 (GRCm39) D522G probably damaging Het
Pclo T A 5: 14,590,759 (GRCm39) C1020S unknown Het
Pfkfb4 T G 9: 108,834,667 (GRCm39) D113E possibly damaging Het
Plod3 A G 5: 137,017,830 (GRCm39) Y202C probably damaging Het
Pmp22 T A 11: 63,049,090 (GRCm39) M111K probably damaging Het
Pom121l2 A G 13: 22,167,789 (GRCm39) T687A probably benign Het
Psmd6 A G 14: 14,114,181 (GRCm38) S313P probably damaging Het
Rd3 T G 1: 191,715,228 (GRCm39) M1R probably null Het
Rtn4ip1 G A 10: 43,804,352 (GRCm39) V235I probably benign Het
Senp5 T C 16: 31,787,719 (GRCm39) I635V probably damaging Het
Stox2 T C 8: 47,645,108 (GRCm39) E784G possibly damaging Het
Syce2 A T 8: 85,613,795 (GRCm39) D168V probably benign Het
Taar6 A G 10: 23,861,529 (GRCm39) S6P probably benign Het
Tbc1d16 A C 11: 119,039,784 (GRCm39) H675Q probably damaging Het
Tmem151b A T 17: 45,856,327 (GRCm39) I371N probably damaging Het
Trim31 A T 17: 37,218,150 (GRCm39) probably null Het
Usp48 A G 4: 137,338,029 (GRCm39) Y268C probably damaging Het
Vmn2r11 A G 5: 109,207,270 (GRCm39) S17P probably benign Het
Vmn2r110 T A 17: 20,804,627 (GRCm39) N98Y probably benign Het
Vps13b T A 15: 35,446,891 (GRCm39) D515E probably benign Het
Yeats2 T G 16: 19,971,684 (GRCm39) I42M probably damaging Het
Other mutations in Pole2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pole2 APN 12 69,273,219 (GRCm39) splice site probably benign
IGL00940:Pole2 APN 12 69,262,134 (GRCm39) missense probably damaging 1.00
IGL01593:Pole2 APN 12 69,269,873 (GRCm39) splice site probably null
IGL01609:Pole2 APN 12 69,254,631 (GRCm39) critical splice donor site probably null
IGL01717:Pole2 APN 12 69,260,623 (GRCm39) missense probably damaging 1.00
IGL02168:Pole2 APN 12 69,248,660 (GRCm39) unclassified probably benign
IGL02208:Pole2 APN 12 69,269,936 (GRCm39) missense possibly damaging 0.91
IGL02966:Pole2 APN 12 69,256,649 (GRCm39) missense probably damaging 1.00
PIT4504001:Pole2 UTSW 12 69,256,759 (GRCm39) nonsense probably null
R0069:Pole2 UTSW 12 69,256,661 (GRCm39) missense probably damaging 1.00
R0069:Pole2 UTSW 12 69,256,661 (GRCm39) missense probably damaging 1.00
R0396:Pole2 UTSW 12 69,269,160 (GRCm39) splice site probably benign
R0574:Pole2 UTSW 12 69,258,231 (GRCm39) splice site probably benign
R0620:Pole2 UTSW 12 69,256,653 (GRCm39) missense probably damaging 1.00
R0685:Pole2 UTSW 12 69,258,187 (GRCm39) missense probably damaging 0.98
R0791:Pole2 UTSW 12 69,254,703 (GRCm39) missense probably benign 0.06
R1452:Pole2 UTSW 12 69,254,703 (GRCm39) missense probably benign 0.06
R1453:Pole2 UTSW 12 69,254,703 (GRCm39) missense probably benign 0.06
R1455:Pole2 UTSW 12 69,254,703 (GRCm39) missense probably benign 0.06
R1912:Pole2 UTSW 12 69,256,764 (GRCm39) missense probably damaging 0.99
R2067:Pole2 UTSW 12 69,274,926 (GRCm39) missense probably benign 0.01
R2929:Pole2 UTSW 12 69,256,712 (GRCm39) missense probably benign 0.13
R3016:Pole2 UTSW 12 69,268,836 (GRCm39) missense probably benign 0.14
R4504:Pole2 UTSW 12 69,269,242 (GRCm39) missense probably benign 0.00
R4765:Pole2 UTSW 12 69,268,826 (GRCm39) missense possibly damaging 0.49
R4790:Pole2 UTSW 12 69,273,139 (GRCm39) missense probably benign 0.00
R4896:Pole2 UTSW 12 69,269,924 (GRCm39) missense probably damaging 0.97
R6998:Pole2 UTSW 12 69,260,680 (GRCm39) missense possibly damaging 0.82
R7257:Pole2 UTSW 12 69,249,684 (GRCm39) missense probably damaging 1.00
R7535:Pole2 UTSW 12 69,269,203 (GRCm39) missense probably benign 0.10
R7841:Pole2 UTSW 12 69,251,032 (GRCm39) missense probably damaging 1.00
R8437:Pole2 UTSW 12 69,250,961 (GRCm39) nonsense probably null
R9467:Pole2 UTSW 12 69,255,719 (GRCm39) missense probably benign 0.40
R9494:Pole2 UTSW 12 69,249,731 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ACCCTGGGATCAACTTGTTCTC -3'
(R):5'- CCAGGCTTTGAAAGGTATTGAGC -3'

Sequencing Primer
(F):5'- CACTATAGATGGTTGTGAGCCACC -3'
(R):5'- AAGAGTGTTTCCAATCCCGG -3'
Posted On 2020-10-20