Incidental Mutation 'R8506:Celsr1'
ID655599
Institutional Source Beutler Lab
Gene Symbol Celsr1
Ensembl Gene ENSMUSG00000016028
Gene Namecadherin, EGF LAG seven-pass G-type receptor 1
Synonymscrash, Crsh, Scy
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.860) question?
Stock #R8506 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location85898929-86033777 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 86033085 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 229 (S229*)
Ref Sequence ENSEMBL: ENSMUSP00000016172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016172]
Predicted Effect probably null
Transcript: ENSMUST00000016172
AA Change: S229*
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: S229*

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik A T 9: 101,942,972 E197V possibly damaging Het
Alkbh8 C T 9: 3,335,616 probably benign Het
Ank1 G A 8: 23,096,835 A498T probably damaging Het
Antxr1 T A 6: 87,188,173 E427D possibly damaging Het
App A C 16: 85,082,816 V143G unknown Het
Bod1l C A 5: 41,819,055 E1639* probably null Het
C2cd2 T C 16: 97,875,421 D122G Het
Ccdc88b G T 19: 6,847,322 P1357T probably damaging Het
Ccnyl1 A G 1: 64,714,662 T211A possibly damaging Het
Cdc25a T C 9: 109,891,752 Y434H probably damaging Het
Ceacam16 C A 7: 19,852,270 A106S unknown Het
Chpf2 T C 5: 24,588,297 L87P probably damaging Het
Col5a2 A T 1: 45,442,784 I60N unknown Het
Cux1 T A 5: 136,308,504 E718V probably damaging Het
Dchs2 A T 3: 83,301,174 I1845L probably benign Het
Disp3 C T 4: 148,241,570 V1244I possibly damaging Het
Dnah8 T C 17: 30,721,134 S1685P probably benign Het
Etnppl G A 3: 130,629,473 V274I possibly damaging Het
Evc2 T C 5: 37,383,142 S561P probably damaging Het
Fga A G 3: 83,033,316 E759G probably damaging Het
Gdpd5 T C 7: 99,453,950 F372S probably benign Het
Gpr155 T C 2: 73,343,462 T868A probably damaging Het
Herc1 A G 9: 66,473,581 D3580G possibly damaging Het
Hmbs A G 9: 44,341,624 probably null Het
Ibsp A T 5: 104,310,081 E161D probably damaging Het
Ighv8-4 A G 12: 115,024,108 V90A possibly damaging Het
Itpr2 A G 6: 146,418,416 probably null Het
Kcnc2 T A 10: 112,455,632 F242I probably damaging Het
Kcnj5 A G 9: 32,322,332 I229T probably damaging Het
Lamb1 A T 12: 31,329,361 L1791F probably damaging Het
Med6 A T 12: 81,594,960 M1K probably null Het
Mei4 A G 9: 81,979,238 D294G probably benign Het
Nat10 T C 2: 103,732,237 I585V probably benign Het
Nid1 T C 13: 13,476,174 V432A probably damaging Het
Nlrp4c G T 7: 6,100,776 G903V possibly damaging Het
Nrf1 G A 6: 30,126,257 A416T probably benign Het
Nsl1 G C 1: 191,076,635 C173S unknown Het
Obsl1 G A 1: 75,505,656 A190V probably benign Het
Olfr1047 A G 2: 86,228,578 L131P possibly damaging Het
Olfr1085 T C 2: 86,658,401 D19G probably benign Het
Olfr1151 A T 2: 87,857,837 I221F probably damaging Het
Olfr1469 A G 19: 13,411,240 T224A possibly damaging Het
Olfr535 G A 7: 140,493,423 V262I probably benign Het
Olfr583 T A 7: 103,051,502 M68K probably damaging Het
Osbpl1a G A 18: 12,768,586 T621I probably benign Het
Pabpc4l G A 3: 46,446,397 R271* probably null Het
Paics A T 5: 76,964,590 D307V possibly damaging Het
Pcdhga9 A G 18: 37,738,684 D522G probably damaging Het
Pclo T A 5: 14,540,745 C1020S unknown Het
Pfkfb4 T G 9: 109,005,599 D113E possibly damaging Het
Plod3 A G 5: 136,988,976 Y202C probably damaging Het
Pmp22 T A 11: 63,158,264 M111K probably damaging Het
Pole2 A C 12: 69,208,960 S344A probably benign Het
Pom121l2 A G 13: 21,983,619 T687A probably benign Het
Psmd6 A G 14: 14,114,181 S313P probably damaging Het
Rd3 T G 1: 191,983,267 M1R probably null Het
Rtn4ip1 G A 10: 43,928,356 V235I probably benign Het
Senp5 T C 16: 31,968,901 I635V probably damaging Het
Stox2 T C 8: 47,192,073 E784G possibly damaging Het
Syce2 A T 8: 84,887,166 D168V probably benign Het
Taar6 A G 10: 23,985,631 S6P probably benign Het
Tbc1d16 A C 11: 119,148,958 H675Q probably damaging Het
Tmem151b A T 17: 45,545,401 I371N probably damaging Het
Trim31 A T 17: 36,907,258 probably null Het
Usp48 A G 4: 137,610,718 Y268C probably damaging Het
Vmn2r11 A G 5: 109,059,404 S17P probably benign Het
Vmn2r110 T A 17: 20,584,365 N98Y probably benign Het
Vps13b T A 15: 35,446,745 D515E probably benign Het
Yeats2 T G 16: 20,152,934 I42M probably damaging Het
Other mutations in Celsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Celsr1 APN 15 85931345 missense probably benign 0.04
IGL00519:Celsr1 APN 15 86030836 missense probably damaging 1.00
IGL00909:Celsr1 APN 15 85922235 missense probably damaging 1.00
IGL01303:Celsr1 APN 15 86030491 missense probably damaging 0.97
IGL01726:Celsr1 APN 15 85926190 missense probably benign 0.35
IGL01910:Celsr1 APN 15 85929895 missense probably benign
IGL01931:Celsr1 APN 15 85907660 missense probably damaging 1.00
IGL01952:Celsr1 APN 15 85963223 missense probably benign 0.35
IGL02090:Celsr1 APN 15 85907721 missense possibly damaging 0.49
IGL02191:Celsr1 APN 15 85979004 missense possibly damaging 0.69
IGL02372:Celsr1 APN 15 85929907 missense probably benign 0.01
IGL02413:Celsr1 APN 15 86031226 missense possibly damaging 0.96
IGL02478:Celsr1 APN 15 85941136 missense possibly damaging 0.68
IGL02507:Celsr1 APN 15 85900688 utr 3 prime probably benign
IGL02508:Celsr1 APN 15 86030617 nonsense probably null
IGL02899:Celsr1 APN 15 86031726 missense probably damaging 0.98
IGL02939:Celsr1 APN 15 85901472 missense probably benign
IGL03212:Celsr1 APN 15 85930677 missense probably benign 0.04
P0028:Celsr1 UTSW 15 85922235 missense probably damaging 1.00
PIT4305001:Celsr1 UTSW 15 85900937 missense possibly damaging 0.87
PIT4480001:Celsr1 UTSW 15 86032414 missense probably damaging 0.99
R0018:Celsr1 UTSW 15 86031042 missense possibly damaging 0.47
R0018:Celsr1 UTSW 15 86031042 missense possibly damaging 0.47
R0038:Celsr1 UTSW 15 85929419 missense possibly damaging 0.65
R0057:Celsr1 UTSW 15 86030762 missense probably benign 0.02
R0060:Celsr1 UTSW 15 85922198 missense probably damaging 0.98
R0060:Celsr1 UTSW 15 85922198 missense probably damaging 0.98
R0279:Celsr1 UTSW 15 85902864 missense probably benign 0.00
R0570:Celsr1 UTSW 15 85903365 missense probably benign 0.18
R0611:Celsr1 UTSW 15 85932323 missense possibly damaging 0.91
R0731:Celsr1 UTSW 15 85901597 missense probably benign
R0792:Celsr1 UTSW 15 85931276 missense probably benign 0.02
R0943:Celsr1 UTSW 15 85903288 missense probably damaging 1.00
R0989:Celsr1 UTSW 15 86031279 missense probably benign 0.39
R1118:Celsr1 UTSW 15 86032047 missense probably damaging 1.00
R1237:Celsr1 UTSW 15 85903974 missense probably benign 0.01
R1239:Celsr1 UTSW 15 85979146 missense probably damaging 0.99
R1405:Celsr1 UTSW 15 85905434 splice site probably null
R1405:Celsr1 UTSW 15 85905434 splice site probably null
R1522:Celsr1 UTSW 15 85931276 missense probably benign 0.02
R1662:Celsr1 UTSW 15 86031062 missense probably damaging 1.00
R1673:Celsr1 UTSW 15 85932457 missense probably benign 0.00
R1795:Celsr1 UTSW 15 86030323 missense probably damaging 0.99
R1799:Celsr1 UTSW 15 86032685 missense probably damaging 1.00
R1858:Celsr1 UTSW 15 86032759 missense probably damaging 1.00
R2040:Celsr1 UTSW 15 86032887 missense probably damaging 1.00
R2050:Celsr1 UTSW 15 86030547 missense probably benign 0.02
R2131:Celsr1 UTSW 15 85963223 missense probably benign 0.35
R2132:Celsr1 UTSW 15 86031967 missense possibly damaging 0.91
R2189:Celsr1 UTSW 15 85979230 missense possibly damaging 0.93
R2192:Celsr1 UTSW 15 85916723 missense possibly damaging 0.93
R4213:Celsr1 UTSW 15 86031807 missense probably damaging 1.00
R4356:Celsr1 UTSW 15 85978827 missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85963133 missense probably benign 0.00
R4414:Celsr1 UTSW 15 85927999 missense probably damaging 1.00
R4416:Celsr1 UTSW 15 85927999 missense probably damaging 1.00
R4645:Celsr1 UTSW 15 85916756 missense probably benign 0.35
R4666:Celsr1 UTSW 15 86030494 missense probably damaging 1.00
R4687:Celsr1 UTSW 15 85932460 missense possibly damaging 0.94
R4735:Celsr1 UTSW 15 85906029 critical splice acceptor site probably null
R4804:Celsr1 UTSW 15 85937953 missense possibly damaging 0.49
R4995:Celsr1 UTSW 15 85937911 missense probably damaging 0.99
R5070:Celsr1 UTSW 15 85939134 missense possibly damaging 0.89
R5218:Celsr1 UTSW 15 85932384 missense probably damaging 1.00
R5280:Celsr1 UTSW 15 85930546 missense probably benign
R5310:Celsr1 UTSW 15 85926222 missense possibly damaging 0.88
R5388:Celsr1 UTSW 15 85925518 missense probably damaging 0.99
R5484:Celsr1 UTSW 15 85931282 missense probably benign 0.00
R5639:Celsr1 UTSW 15 86030767 missense probably damaging 1.00
R5758:Celsr1 UTSW 15 85941264 missense probably benign 0.27
R5778:Celsr1 UTSW 15 86032955 missense probably damaging 1.00
R5893:Celsr1 UTSW 15 85904014 missense probably benign 0.02
R5915:Celsr1 UTSW 15 85937975 missense probably benign
R5915:Celsr1 UTSW 15 86030349 missense probably damaging 0.96
R5932:Celsr1 UTSW 15 86032704 missense probably damaging 1.00
R5950:Celsr1 UTSW 15 86032500 missense probably damaging 1.00
R5975:Celsr1 UTSW 15 85919038 splice site probably null
R6050:Celsr1 UTSW 15 85930611 missense probably benign 0.00
R6117:Celsr1 UTSW 15 85932411 missense probably benign 0.04
R6178:Celsr1 UTSW 15 85901021 missense probably benign 0.08
R6186:Celsr1 UTSW 15 85921193 missense possibly damaging 0.84
R6212:Celsr1 UTSW 15 85916687 missense probably benign 0.25
R6307:Celsr1 UTSW 15 85928330 missense probably benign
R6320:Celsr1 UTSW 15 85900959 missense probably benign 0.13
R6349:Celsr1 UTSW 15 86031684 missense probably damaging 1.00
R6478:Celsr1 UTSW 15 85925518 missense probably damaging 0.99
R6504:Celsr1 UTSW 15 85978920 missense probably benign 0.07
R6607:Celsr1 UTSW 15 85963285 missense probably benign
R6615:Celsr1 UTSW 15 85902114 critical splice donor site probably null
R6661:Celsr1 UTSW 15 85918934 missense probably damaging 1.00
R6722:Celsr1 UTSW 15 85905914 critical splice donor site probably null
R6743:Celsr1 UTSW 15 85907598 missense probably damaging 0.96
R6746:Celsr1 UTSW 15 86031495 missense probably damaging 1.00
R6772:Celsr1 UTSW 15 86030782 missense probably benign
R6838:Celsr1 UTSW 15 85939194 missense probably benign
R6886:Celsr1 UTSW 15 86031654 missense probably benign 0.00
R7030:Celsr1 UTSW 15 85905478 missense probably damaging 0.99
R7060:Celsr1 UTSW 15 86032655 missense probably benign 0.07
R7080:Celsr1 UTSW 15 85932451 missense possibly damaging 0.87
R7325:Celsr1 UTSW 15 86033008 missense probably damaging 0.99
R7357:Celsr1 UTSW 15 86030514 missense probably benign 0.00
R7371:Celsr1 UTSW 15 86030674 missense possibly damaging 0.91
R7446:Celsr1 UTSW 15 85907673 missense possibly damaging 0.95
R7465:Celsr1 UTSW 15 86033392 missense probably benign
R7491:Celsr1 UTSW 15 86032518 missense possibly damaging 0.78
R7639:Celsr1 UTSW 15 85929872 missense probably benign 0.00
R7685:Celsr1 UTSW 15 85978732 nonsense probably null
R7741:Celsr1 UTSW 15 85979102 missense possibly damaging 0.94
R7768:Celsr1 UTSW 15 85932409 missense probably benign
R7974:Celsr1 UTSW 15 86031030 missense probably damaging 1.00
R7977:Celsr1 UTSW 15 86032993 missense probably damaging 1.00
R7987:Celsr1 UTSW 15 86032993 missense probably damaging 1.00
R8073:Celsr1 UTSW 15 85939155 missense probably benign 0.00
R8099:Celsr1 UTSW 15 86031600 missense probably damaging 0.99
R8190:Celsr1 UTSW 15 85902889 missense probably damaging 0.99
R8210:Celsr1 UTSW 15 85979235 missense probably benign 0.00
R8289:Celsr1 UTSW 15 86033085 nonsense probably null
R8290:Celsr1 UTSW 15 86033085 nonsense probably null
R8292:Celsr1 UTSW 15 85907618 missense possibly damaging 0.90
R8328:Celsr1 UTSW 15 85922244 missense probably benign 0.00
R8330:Celsr1 UTSW 15 85932300 missense probably damaging 0.99
R8333:Celsr1 UTSW 15 86031414 missense possibly damaging 0.65
R8352:Celsr1 UTSW 15 86033085 nonsense probably null
R8384:Celsr1 UTSW 15 86033085 nonsense probably null
R8452:Celsr1 UTSW 15 86033085 nonsense probably null
R8463:Celsr1 UTSW 15 86030214 missense probably damaging 1.00
R8479:Celsr1 UTSW 15 86033085 nonsense probably null
R8480:Celsr1 UTSW 15 86033085 nonsense probably null
R8493:Celsr1 UTSW 15 85938006 missense possibly damaging 0.67
R8498:Celsr1 UTSW 15 85939105 missense probably benign 0.01
Z1176:Celsr1 UTSW 15 85963100 missense probably damaging 0.96
Z1177:Celsr1 UTSW 15 85978851 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGGTAGCTAAGGCGTCC -3'
(R):5'- TTGAGGCCATCACCAACTTC -3'

Sequencing Primer
(F):5'- ATCGCCTTCGTCTGGGTCG -3'
(R):5'- AACTTCCCCGCCTGCAG -3'
Posted On2020-10-20