Incidental Mutation 'R8506:Osbpl1a'
ID 655608
Institutional Source Beutler Lab
Gene Symbol Osbpl1a
Ensembl Gene ENSMUSG00000044252
Gene Name oxysterol binding protein-like 1A
Synonyms LOC328902, G430090F17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock # R8506 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 12755314-12941841 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 12768586 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 621 (T621I)
Ref Sequence ENSEMBL: ENSMUSP00000073957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074352] [ENSMUST00000117361] [ENSMUST00000118313] [ENSMUST00000119043] [ENSMUST00000119512] [ENSMUST00000121774] [ENSMUST00000121808] [ENSMUST00000121888] [ENSMUST00000143077] [ENSMUST00000155650]
AlphaFold Q91XL9
Predicted Effect probably benign
Transcript: ENSMUST00000074352
AA Change: T621I

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000073957
Gene: ENSMUSG00000044252
AA Change: T621I

DomainStartEndE-ValueType
ANK 47 76 2.05e-6 SMART
ANK 80 109 1.29e-3 SMART
low complexity region 141 153 N/A INTRINSIC
ANK 175 204 1.31e-4 SMART
PH 236 336 6.02e-8 SMART
low complexity region 345 354 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Pfam:Oxysterol_BP 548 940 6.7e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117361
AA Change: T108I

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112681
Gene: ENSMUSG00000044252
AA Change: T108I

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118313
AA Change: T108I

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113735
Gene: ENSMUSG00000044252
AA Change: T108I

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119043
AA Change: T108I

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113357
Gene: ENSMUSG00000044252
AA Change: T108I

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119512
AA Change: T229I

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113914
Gene: ENSMUSG00000044252
AA Change: T229I

DomainStartEndE-ValueType
coiled coil region 38 71 N/A INTRINSIC
Pfam:Oxysterol_BP 156 549 1.2e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121774
AA Change: T81I

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113268
Gene: ENSMUSG00000044252
AA Change: T81I

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 8 401 4e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121808
AA Change: T108I

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113841
Gene: ENSMUSG00000044252
AA Change: T108I

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121888
AA Change: T108I

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112895
Gene: ENSMUSG00000044252
AA Change: T108I

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143077
AA Change: T108I

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000122967
Gene: ENSMUSG00000044252
AA Change: T108I

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 184 3.5e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155650
SMART Domains Protein: ENSMUSP00000120439
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
coiled coil region 13 46 N/A INTRINSIC
Pfam:Oxysterol_BP 131 187 1.3e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. Transcript variants derived from alternative promoter usage and/or alternative splicing exist; they encode different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik A T 9: 101,942,972 E197V possibly damaging Het
Alkbh8 C T 9: 3,335,616 probably benign Het
Ank1 G A 8: 23,096,835 A498T probably damaging Het
Antxr1 T A 6: 87,188,173 E427D possibly damaging Het
App A C 16: 85,082,816 V143G unknown Het
Bod1l C A 5: 41,819,055 E1639* probably null Het
C2cd2 T C 16: 97,875,421 D122G Het
Ccdc88b G T 19: 6,847,322 P1357T probably damaging Het
Ccnyl1 A G 1: 64,714,662 T211A possibly damaging Het
Cdc25a T C 9: 109,891,752 Y434H probably damaging Het
Ceacam16 C A 7: 19,852,270 A106S unknown Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Chpf2 T C 5: 24,588,297 L87P probably damaging Het
Col5a2 A T 1: 45,442,784 I60N unknown Het
Cux1 T A 5: 136,308,504 E718V probably damaging Het
Dchs2 A T 3: 83,301,174 I1845L probably benign Het
Disp3 C T 4: 148,241,570 V1244I possibly damaging Het
Dnah8 T C 17: 30,721,134 S1685P probably benign Het
Etnppl G A 3: 130,629,473 V274I possibly damaging Het
Evc2 T C 5: 37,383,142 S561P probably damaging Het
Fga A G 3: 83,033,316 E759G probably damaging Het
Gdpd5 T C 7: 99,453,950 F372S probably benign Het
Gpr155 T C 2: 73,343,462 T868A probably damaging Het
Herc1 A G 9: 66,473,581 D3580G possibly damaging Het
Hmbs A G 9: 44,341,624 probably null Het
Ibsp A T 5: 104,310,081 E161D probably damaging Het
Ighv8-4 A G 12: 115,024,108 V90A possibly damaging Het
Itpr2 A G 6: 146,418,416 probably null Het
Kcnc2 T A 10: 112,455,632 F242I probably damaging Het
Kcnj5 A G 9: 32,322,332 I229T probably damaging Het
Lamb1 A T 12: 31,329,361 L1791F probably damaging Het
Med6 A T 12: 81,594,960 M1K probably null Het
Mei4 A G 9: 81,979,238 D294G probably benign Het
Nat10 T C 2: 103,732,237 I585V probably benign Het
Nid1 T C 13: 13,476,174 V432A probably damaging Het
Nlrp4c G T 7: 6,100,776 G903V possibly damaging Het
Nrf1 G A 6: 30,126,257 A416T probably benign Het
Nsl1 G C 1: 191,076,635 C173S unknown Het
Obsl1 G A 1: 75,505,656 A190V probably benign Het
Olfr1047 A G 2: 86,228,578 L131P possibly damaging Het
Olfr1085 T C 2: 86,658,401 D19G probably benign Het
Olfr1151 A T 2: 87,857,837 I221F probably damaging Het
Olfr1469 A G 19: 13,411,240 T224A possibly damaging Het
Olfr535 G A 7: 140,493,423 V262I probably benign Het
Olfr583 T A 7: 103,051,502 M68K probably damaging Het
Pabpc4l G A 3: 46,446,397 R271* probably null Het
Paics A T 5: 76,964,590 D307V possibly damaging Het
Pcdhga9 A G 18: 37,738,684 D522G probably damaging Het
Pclo T A 5: 14,540,745 C1020S unknown Het
Pfkfb4 T G 9: 109,005,599 D113E possibly damaging Het
Plod3 A G 5: 136,988,976 Y202C probably damaging Het
Pmp22 T A 11: 63,158,264 M111K probably damaging Het
Pole2 A C 12: 69,208,960 S344A probably benign Het
Pom121l2 A G 13: 21,983,619 T687A probably benign Het
Psmd6 A G 14: 14,114,181 S313P probably damaging Het
Rd3 T G 1: 191,983,267 M1R probably null Het
Rtn4ip1 G A 10: 43,928,356 V235I probably benign Het
Senp5 T C 16: 31,968,901 I635V probably damaging Het
Stox2 T C 8: 47,192,073 E784G possibly damaging Het
Syce2 A T 8: 84,887,166 D168V probably benign Het
Taar6 A G 10: 23,985,631 S6P probably benign Het
Tbc1d16 A C 11: 119,148,958 H675Q probably damaging Het
Tmem151b A T 17: 45,545,401 I371N probably damaging Het
Trim31 A T 17: 36,907,258 probably null Het
Usp48 A G 4: 137,610,718 Y268C probably damaging Het
Vmn2r11 A G 5: 109,059,404 S17P probably benign Het
Vmn2r110 T A 17: 20,584,365 N98Y probably benign Het
Vps13b T A 15: 35,446,745 D515E probably benign Het
Yeats2 T G 16: 20,152,934 I42M probably damaging Het
Other mutations in Osbpl1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Osbpl1a APN 18 12757626 missense possibly damaging 0.51
IGL01062:Osbpl1a APN 18 12905075 missense probably benign
IGL01450:Osbpl1a APN 18 12871095 missense possibly damaging 0.88
IGL01531:Osbpl1a APN 18 12933581 missense probably damaging 1.00
IGL01548:Osbpl1a APN 18 12763575 missense probably damaging 1.00
IGL01606:Osbpl1a APN 18 12756214 missense possibly damaging 0.79
IGL01672:Osbpl1a APN 18 12766824 missense probably damaging 1.00
IGL02372:Osbpl1a APN 18 12841313 nonsense probably null
IGL02451:Osbpl1a APN 18 12914493 splice site probably benign
IGL02490:Osbpl1a APN 18 12882284 unclassified probably benign
IGL02884:Osbpl1a APN 18 12819578 nonsense probably null
R0084:Osbpl1a UTSW 18 12757612 missense probably benign 0.07
R0266:Osbpl1a UTSW 18 12871163 splice site probably null
R0565:Osbpl1a UTSW 18 12759444 missense probably damaging 1.00
R0605:Osbpl1a UTSW 18 12882279 critical splice acceptor site probably null
R0899:Osbpl1a UTSW 18 12757690 missense possibly damaging 0.70
R1330:Osbpl1a UTSW 18 12882194 critical splice donor site probably null
R1464:Osbpl1a UTSW 18 12914558 missense probably benign
R1464:Osbpl1a UTSW 18 12914558 missense probably benign
R1475:Osbpl1a UTSW 18 12757680 missense probably damaging 1.00
R1495:Osbpl1a UTSW 18 12758839 missense probably benign 0.08
R1734:Osbpl1a UTSW 18 12788316 splice site probably null
R1930:Osbpl1a UTSW 18 12905194 missense probably benign 0.04
R1931:Osbpl1a UTSW 18 12905194 missense probably benign 0.04
R2109:Osbpl1a UTSW 18 12759400 missense probably damaging 1.00
R2144:Osbpl1a UTSW 18 12871173 missense probably benign 0.06
R2504:Osbpl1a UTSW 18 12905031 missense probably benign 0.30
R2762:Osbpl1a UTSW 18 12766899 missense possibly damaging 0.83
R2907:Osbpl1a UTSW 18 12871072 unclassified probably benign
R4306:Osbpl1a UTSW 18 12819595 missense probably benign
R4835:Osbpl1a UTSW 18 12768536 critical splice donor site probably null
R5097:Osbpl1a UTSW 18 12763537 missense probably damaging 1.00
R5173:Osbpl1a UTSW 18 12762640 missense probably benign 0.12
R5224:Osbpl1a UTSW 18 12933696 missense probably benign 0.01
R5245:Osbpl1a UTSW 18 12758853 missense probably damaging 1.00
R5579:Osbpl1a UTSW 18 12841192 missense probably damaging 1.00
R5579:Osbpl1a UTSW 18 12892262 missense probably benign 0.22
R5833:Osbpl1a UTSW 18 12788362 missense probably damaging 1.00
R5986:Osbpl1a UTSW 18 12905081 missense probably damaging 1.00
R6267:Osbpl1a UTSW 18 12819503 critical splice donor site probably null
R6296:Osbpl1a UTSW 18 12819503 critical splice donor site probably null
R6477:Osbpl1a UTSW 18 12756261 missense probably benign 0.03
R6997:Osbpl1a UTSW 18 12756224 missense probably benign 0.05
R7105:Osbpl1a UTSW 18 12766963 missense probably benign 0.17
R7107:Osbpl1a UTSW 18 12841253 nonsense probably null
R7154:Osbpl1a UTSW 18 12768592 missense probably benign 0.00
R7459:Osbpl1a UTSW 18 12933585 missense probably damaging 1.00
R7757:Osbpl1a UTSW 18 12933600 missense probably benign 0.44
R7797:Osbpl1a UTSW 18 12882264 missense probably damaging 0.99
R8029:Osbpl1a UTSW 18 12914521 missense probably benign 0.01
R8084:Osbpl1a UTSW 18 12905042 missense probably damaging 1.00
R8947:Osbpl1a UTSW 18 12766801 critical splice donor site probably null
R9069:Osbpl1a UTSW 18 12869017 intron probably benign
R9085:Osbpl1a UTSW 18 12929036 missense probably damaging 1.00
R9288:Osbpl1a UTSW 18 12771345 missense probably damaging 1.00
R9443:Osbpl1a UTSW 18 12898187 missense probably benign 0.00
R9517:Osbpl1a UTSW 18 12909908 missense probably benign
R9600:Osbpl1a UTSW 18 12882220 missense probably benign 0.00
R9658:Osbpl1a UTSW 18 12756212 missense probably benign 0.05
R9694:Osbpl1a UTSW 18 12819508 missense probably benign 0.03
X0027:Osbpl1a UTSW 18 12759503 missense possibly damaging 0.46
Z1177:Osbpl1a UTSW 18 12906923 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTCAAGTTTCATAGACATGGACATC -3'
(R):5'- TGGCACTGTAGGATGAGATCTAG -3'

Sequencing Primer
(F):5'- CACCTAGAATGGAGCAGA -3'
(R):5'- GAGTGTACACGCTTCTACAGTAACG -3'
Posted On 2020-10-20