Incidental Mutation 'R8506:Olfr1469'
ID655611
Institutional Source Beutler Lab
Gene Symbol Olfr1469
Ensembl Gene ENSMUSG00000063777
Gene Nameolfactory receptor 1469
SynonymsGA_x6K02T2RE5P-3743369-3744289, MOR202-11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R8506 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location13407849-13414540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13411240 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 224 (T224A)
Ref Sequence ENSEMBL: ENSMUSP00000150006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077538] [ENSMUST00000216910]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077538
AA Change: T224A

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076741
Gene: ENSMUSG00000063777
AA Change: T224A

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2e-47 PFAM
Pfam:7tm_1 42 290 2.3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216910
AA Change: T224A

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik A T 9: 101,942,972 E197V possibly damaging Het
Alkbh8 C T 9: 3,335,616 probably benign Het
Ank1 G A 8: 23,096,835 A498T probably damaging Het
Antxr1 T A 6: 87,188,173 E427D possibly damaging Het
App A C 16: 85,082,816 V143G unknown Het
Bod1l C A 5: 41,819,055 E1639* probably null Het
C2cd2 T C 16: 97,875,421 D122G Het
Ccdc88b G T 19: 6,847,322 P1357T probably damaging Het
Ccnyl1 A G 1: 64,714,662 T211A possibly damaging Het
Cdc25a T C 9: 109,891,752 Y434H probably damaging Het
Ceacam16 C A 7: 19,852,270 A106S unknown Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Chpf2 T C 5: 24,588,297 L87P probably damaging Het
Col5a2 A T 1: 45,442,784 I60N unknown Het
Cux1 T A 5: 136,308,504 E718V probably damaging Het
Dchs2 A T 3: 83,301,174 I1845L probably benign Het
Disp3 C T 4: 148,241,570 V1244I possibly damaging Het
Dnah8 T C 17: 30,721,134 S1685P probably benign Het
Etnppl G A 3: 130,629,473 V274I possibly damaging Het
Evc2 T C 5: 37,383,142 S561P probably damaging Het
Fga A G 3: 83,033,316 E759G probably damaging Het
Gdpd5 T C 7: 99,453,950 F372S probably benign Het
Gpr155 T C 2: 73,343,462 T868A probably damaging Het
Herc1 A G 9: 66,473,581 D3580G possibly damaging Het
Hmbs A G 9: 44,341,624 probably null Het
Ibsp A T 5: 104,310,081 E161D probably damaging Het
Ighv8-4 A G 12: 115,024,108 V90A possibly damaging Het
Itpr2 A G 6: 146,418,416 probably null Het
Kcnc2 T A 10: 112,455,632 F242I probably damaging Het
Kcnj5 A G 9: 32,322,332 I229T probably damaging Het
Lamb1 A T 12: 31,329,361 L1791F probably damaging Het
Med6 A T 12: 81,594,960 M1K probably null Het
Mei4 A G 9: 81,979,238 D294G probably benign Het
Nat10 T C 2: 103,732,237 I585V probably benign Het
Nid1 T C 13: 13,476,174 V432A probably damaging Het
Nlrp4c G T 7: 6,100,776 G903V possibly damaging Het
Nrf1 G A 6: 30,126,257 A416T probably benign Het
Nsl1 G C 1: 191,076,635 C173S unknown Het
Obsl1 G A 1: 75,505,656 A190V probably benign Het
Olfr1047 A G 2: 86,228,578 L131P possibly damaging Het
Olfr1085 T C 2: 86,658,401 D19G probably benign Het
Olfr1151 A T 2: 87,857,837 I221F probably damaging Het
Olfr535 G A 7: 140,493,423 V262I probably benign Het
Olfr583 T A 7: 103,051,502 M68K probably damaging Het
Osbpl1a G A 18: 12,768,586 T621I probably benign Het
Pabpc4l G A 3: 46,446,397 R271* probably null Het
Paics A T 5: 76,964,590 D307V possibly damaging Het
Pcdhga9 A G 18: 37,738,684 D522G probably damaging Het
Pclo T A 5: 14,540,745 C1020S unknown Het
Pfkfb4 T G 9: 109,005,599 D113E possibly damaging Het
Plod3 A G 5: 136,988,976 Y202C probably damaging Het
Pmp22 T A 11: 63,158,264 M111K probably damaging Het
Pole2 A C 12: 69,208,960 S344A probably benign Het
Pom121l2 A G 13: 21,983,619 T687A probably benign Het
Psmd6 A G 14: 14,114,181 S313P probably damaging Het
Rd3 T G 1: 191,983,267 M1R probably null Het
Rtn4ip1 G A 10: 43,928,356 V235I probably benign Het
Senp5 T C 16: 31,968,901 I635V probably damaging Het
Stox2 T C 8: 47,192,073 E784G possibly damaging Het
Syce2 A T 8: 84,887,166 D168V probably benign Het
Taar6 A G 10: 23,985,631 S6P probably benign Het
Tbc1d16 A C 11: 119,148,958 H675Q probably damaging Het
Tmem151b A T 17: 45,545,401 I371N probably damaging Het
Trim31 A T 17: 36,907,258 probably null Het
Usp48 A G 4: 137,610,718 Y268C probably damaging Het
Vmn2r11 A G 5: 109,059,404 S17P probably benign Het
Vmn2r110 T A 17: 20,584,365 N98Y probably benign Het
Vps13b T A 15: 35,446,745 D515E probably benign Het
Yeats2 T G 16: 20,152,934 I42M probably damaging Het
Other mutations in Olfr1469
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Olfr1469 APN 19 13411226 missense probably benign 0.01
IGL01520:Olfr1469 APN 19 13410750 missense probably damaging 0.97
IGL01671:Olfr1469 APN 19 13410891 missense probably benign 0.29
IGL02247:Olfr1469 APN 19 13411467 missense probably benign 0.01
IGL02297:Olfr1469 APN 19 13411475 missense probably benign 0.00
IGL02417:Olfr1469 APN 19 13410895 missense possibly damaging 0.52
IGL02442:Olfr1469 APN 19 13410987 missense probably benign 0.00
IGL02989:Olfr1469 APN 19 13411486 missense probably benign
IGL03269:Olfr1469 APN 19 13411428 missense probably damaging 0.99
IGL02988:Olfr1469 UTSW 19 13411462 missense possibly damaging 0.75
R0707:Olfr1469 UTSW 19 13411420 missense probably benign 0.22
R1055:Olfr1469 UTSW 19 13411390 missense probably benign 0.10
R1102:Olfr1469 UTSW 19 13411090 missense probably damaging 1.00
R1946:Olfr1469 UTSW 19 13410779 missense possibly damaging 0.64
R2111:Olfr1469 UTSW 19 13410943 missense probably damaging 0.99
R4072:Olfr1469 UTSW 19 13410935 missense possibly damaging 0.49
R4073:Olfr1469 UTSW 19 13410935 missense possibly damaging 0.49
R4076:Olfr1469 UTSW 19 13410935 missense possibly damaging 0.49
R4726:Olfr1469 UTSW 19 13411105 missense probably damaging 1.00
R4939:Olfr1469 UTSW 19 13410855 missense probably benign 0.10
R5914:Olfr1469 UTSW 19 13410962 missense probably benign 0.31
R6003:Olfr1469 UTSW 19 13411039 missense probably benign 0.34
R6743:Olfr1469 UTSW 19 13410593 missense probably damaging 1.00
R6825:Olfr1469 UTSW 19 13411150 missense probably benign 0.01
R6826:Olfr1469 UTSW 19 13411088 missense probably benign 0.05
R6970:Olfr1469 UTSW 19 13411428 missense probably damaging 0.99
R7558:Olfr1469 UTSW 19 13410991 missense probably damaging 1.00
R7596:Olfr1469 UTSW 19 13411147 missense probably benign 0.01
R7923:Olfr1469 UTSW 19 13410818 missense probably benign 0.17
R8014:Olfr1469 UTSW 19 13410811 missense not run
R8746:Olfr1469 UTSW 19 13410728 missense probably benign 0.44
R8803:Olfr1469 UTSW 19 13410673 missense probably damaging 0.99
Z1177:Olfr1469 UTSW 19 13410719 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGGGACACTTTCAGTCTTTCC -3'
(R):5'- TTCCGCATGCTATAGACCAG -3'

Sequencing Primer
(F):5'- CTTCTGTAGGTCTAATGTAGTGCATC -3'
(R):5'- CGCATGCTATAGACCAGAGGATTC -3'
Posted On2020-10-20