Incidental Mutation 'R8507:Kdsr'
ID655612
Institutional Source Beutler Lab
Gene Symbol Kdsr
Ensembl Gene ENSMUSG00000009905
Gene Name3-ketodihydrosphingosine reductase
SynonymsFvt1, 6330410P18Rik, 9430079B08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R8507 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location106720459-106759727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106743670 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 203 (E203V)
Ref Sequence ENSEMBL: ENSMUSP00000010049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010049]
Predicted Effect probably null
Transcript: ENSMUST00000010049
AA Change: E203V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010049
Gene: ENSMUSG00000009905
AA Change: E203V

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:KR 33 214 9.4e-16 PFAM
Pfam:adh_short 33 232 1.1e-59 PFAM
Pfam:adh_short_C2 39 217 5.7e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the reduction of 3-ketodihydrosphingosine to dihydrosphingosine. The putative active site residues of the encoded protein are found on the cytosolic side of the endoplasmic reticulum membrane. A chromosomal rearrangement involving this gene is a cause of follicular lymphoma, also known as type II chronic lymphatic leukemia. The mutation of a conserved residue in the bovine ortholog causes spinal muscular atrophy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 A G 14: 68,526,324 C126R probably damaging Het
Agpat5 G A 8: 18,878,027 V203I possibly damaging Het
Ankrd12 T A 17: 65,986,909 R510* probably null Het
Anxa6 C T 11: 55,013,870 A22T probably benign Het
Barx2 A T 9: 31,859,013 L73Q probably damaging Het
BC024139 T C 15: 76,120,133 K702R possibly damaging Het
Cc2d1a T C 8: 84,134,976 K739R probably benign Het
Cdk12 A G 11: 98,250,285 T1451A unknown Het
Chd7 A G 4: 8,858,675 E2367G probably damaging Het
Cp A G 3: 19,971,029 Y384C probably damaging Het
Dnah14 T A 1: 181,641,414 W1270R probably benign Het
Dyrk2 G T 10: 118,860,662 S230R probably damaging Het
Epn3 A T 11: 94,493,776 S290R probably damaging Het
Fas C T 19: 34,327,226 R296C probably benign Het
Fmnl1 A T 11: 103,194,033 N659I unknown Het
Gas8 T C 8: 123,531,038 probably null Het
Gpr156 A G 16: 37,948,236 T40A probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Htr3b C A 9: 48,964,877 probably benign Het
Itgal C T 7: 127,329,435 T1044I probably benign Het
Kcnip4 T G 5: 48,482,655 D38A possibly damaging Het
Kcnma1 G T 14: 23,591,638 Q216K probably benign Het
Lrp1b T C 2: 41,408,375 E999G Het
Malt1 T A 18: 65,470,523 W577R probably damaging Het
Mroh2b A C 15: 4,949,090 T1373P probably damaging Het
Mymk A G 2: 27,062,700 probably null Het
Myo1f T A 17: 33,598,018 H707Q probably benign Het
Ncam2 C A 16: 81,512,979 H452Q possibly damaging Het
Ndrg4 A G 8: 95,678,347 M1V probably null Het
Nps C T 7: 135,272,350 S83L probably damaging Het
Nup155 T A 15: 8,147,560 Y1040* probably null Het
Olfr1303 T C 2: 111,814,706 T7A probably benign Het
Olfr190 C T 16: 59,074,880 V67M possibly damaging Het
Olfr316 C T 11: 58,758,159 Q165* probably null Het
Olfr344 T C 2: 36,569,431 Y278H probably damaging Het
Pak1ip1 G A 13: 41,009,294 R191Q probably benign Het
Pcdh17 G A 14: 84,445,944 probably benign Het
Pcdhgc5 G T 18: 37,819,892 R73L probably benign Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Plxnd1 A T 6: 115,966,905 N1144K probably damaging Het
Ppp1r1b G T 11: 98,355,484 E133D probably damaging Het
Ptpn13 A G 5: 103,557,949 E1396G probably damaging Het
Reps1 T C 10: 18,094,470 S272P probably damaging Het
Ric8b T C 10: 84,980,175 V430A probably damaging Het
Sept10 A T 10: 59,177,003 N264K possibly damaging Het
Sgms1 A T 19: 32,159,709 F152L probably benign Het
Snapc1 C A 12: 73,964,732 F57L probably damaging Het
Spidr A G 16: 15,968,676 L401P probably damaging Het
Spn C T 7: 127,136,556 V260M probably damaging Het
Sptan1 G A 2: 30,026,584 A2095T probably damaging Het
Ssfa2 A G 2: 79,644,864 Q389R probably benign Het
Tbc1d15 A G 10: 115,202,502 probably null Het
Thsd7b T A 1: 129,678,053 F510L probably benign Het
Trpm5 T A 7: 143,078,313 I920F probably damaging Het
Tspear C A 10: 77,875,064 H507N probably benign Het
Vmn2r108 T A 17: 20,462,933 K670* probably null Het
Vmn2r75 A T 7: 86,148,477 C709* probably null Het
Wdfy3 G T 5: 101,872,901 S2494R probably benign Het
Zfp456 A T 13: 67,366,989 F199L probably damaging Het
Zfp830 A G 11: 82,764,703 Q111R probably benign Het
Znrf1 G A 8: 111,537,210 A24T probably damaging Het
Other mutations in Kdsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Kdsr APN 1 106755457 missense possibly damaging 0.91
IGL01375:Kdsr APN 1 106727694 missense probably benign 0.06
R0361:Kdsr UTSW 1 106747787 missense probably damaging 0.97
R1051:Kdsr UTSW 1 106747580 nonsense probably null
R1589:Kdsr UTSW 1 106734541 splice site probably null
R1679:Kdsr UTSW 1 106753226 missense probably benign 0.01
R4890:Kdsr UTSW 1 106753234 missense probably benign 0.21
R5392:Kdsr UTSW 1 106753241 missense possibly damaging 0.88
R5500:Kdsr UTSW 1 106759644 unclassified probably benign
R5830:Kdsr UTSW 1 106747532 missense possibly damaging 0.89
R5850:Kdsr UTSW 1 106755442 critical splice donor site probably null
R6005:Kdsr UTSW 1 106734581 missense probably benign 0.01
R7515:Kdsr UTSW 1 106734560 missense possibly damaging 0.89
R7841:Kdsr UTSW 1 106743685 missense probably damaging 1.00
R8282:Kdsr UTSW 1 106724997 missense probably benign 0.03
R8312:Kdsr UTSW 1 106747486 critical splice donor site probably null
R8392:Kdsr UTSW 1 106743853 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGTCATTTTGCCGCTGTC -3'
(R):5'- AATGAGCATAAATTACCTGGGCAG -3'

Sequencing Primer
(F):5'- GAGTCATTTTGCCGCTGTCCTAAG -3'
(R):5'- TAAATTACCTGGGCAGCGTGTACC -3'
Posted On2020-10-20