Incidental Mutation 'R8507:Fmnl1'
ID 655655
Institutional Source Beutler Lab
Gene Symbol Fmnl1
Ensembl Gene ENSMUSG00000055805
Gene Name formin-like 1
Synonyms formin-related gene in leukocytes, 8030453N10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock # R8507 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 103171107-103198901 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103194033 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 659 (N659I)
Ref Sequence ENSEMBL: ENSMUSP00000046296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021323] [ENSMUST00000042286] [ENSMUST00000107026] [ENSMUST00000107027] [ENSMUST00000129726] [ENSMUST00000218163]
AlphaFold Q9JL26
Predicted Effect probably benign
Transcript: ENSMUST00000021323
SMART Domains Protein: ENSMUSP00000021323
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
EFh 109 137 7.23e1 SMART
EFh 145 173 6.68e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000042286
AA Change: N659I
SMART Domains Protein: ENSMUSP00000046296
Gene: ENSMUSG00000055805
AA Change: N659I

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
low complexity region 1074 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107026
SMART Domains Protein: ENSMUSP00000102641
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
EFh 40 68 7.23e1 SMART
EFh 76 104 6.68e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107027
AA Change: N659I
SMART Domains Protein: ENSMUSP00000102642
Gene: ENSMUSG00000055805
AA Change: N659I

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129726
SMART Domains Protein: ENSMUSP00000133299
Gene: ENSMUSG00000055805

DomainStartEndE-ValueType
Pfam:FH2 1 50 8.2e-10 PFAM
low complexity region 124 139 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000218163
AA Change: N665I
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Constitutive homozygous KO is embryonic lethal. Conditional homozygous KO in myeloid cells leads to reduced macrophage migration and podosome formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 A G 14: 68,526,324 C126R probably damaging Het
Agpat5 G A 8: 18,878,027 V203I possibly damaging Het
Ankrd12 T A 17: 65,986,909 R510* probably null Het
Anxa6 C T 11: 55,013,870 A22T probably benign Het
Barx2 A T 9: 31,859,013 L73Q probably damaging Het
BC024139 T C 15: 76,120,133 K702R possibly damaging Het
Cc2d1a T C 8: 84,134,976 K739R probably benign Het
Cdk12 A G 11: 98,250,285 T1451A unknown Het
Chd7 A G 4: 8,858,675 E2367G probably damaging Het
Cp A G 3: 19,971,029 Y384C probably damaging Het
Dnah14 T A 1: 181,641,414 W1270R probably benign Het
Dyrk2 G T 10: 118,860,662 S230R probably damaging Het
Epn3 A T 11: 94,493,776 S290R probably damaging Het
Fas C T 19: 34,327,226 R296C probably benign Het
Gas8 T C 8: 123,531,038 probably null Het
Gpr156 A G 16: 37,948,236 T40A probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Htr3b C A 9: 48,964,877 probably benign Het
Itgal C T 7: 127,329,435 T1044I probably benign Het
Kcnip4 T G 5: 48,482,655 D38A possibly damaging Het
Kcnma1 G T 14: 23,591,638 Q216K probably benign Het
Kdsr T A 1: 106,743,670 E203V probably null Het
Lrp1b T C 2: 41,408,375 E999G Het
Malt1 T A 18: 65,470,523 W577R probably damaging Het
Mroh2b A C 15: 4,949,090 T1373P probably damaging Het
Mymk A G 2: 27,062,700 probably null Het
Myo1f T A 17: 33,598,018 H707Q probably benign Het
Ncam2 C A 16: 81,512,979 H452Q possibly damaging Het
Ndrg4 A G 8: 95,678,347 M1V probably null Het
Nps C T 7: 135,272,350 S83L probably damaging Het
Nup155 T A 15: 8,147,560 Y1040* probably null Het
Olfr1303 T C 2: 111,814,706 T7A probably benign Het
Olfr190 C T 16: 59,074,880 V67M possibly damaging Het
Olfr316 C T 11: 58,758,159 Q165* probably null Het
Olfr344 T C 2: 36,569,431 Y278H probably damaging Het
Pak1ip1 G A 13: 41,009,294 R191Q probably benign Het
Pcdh17 G A 14: 84,445,944 probably benign Het
Pcdhgc5 G T 18: 37,819,892 R73L probably benign Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Plxnd1 A T 6: 115,966,905 N1144K probably damaging Het
Ppp1r1b G T 11: 98,355,484 E133D probably damaging Het
Ptpn13 A G 5: 103,557,949 E1396G probably damaging Het
Reps1 T C 10: 18,094,470 S272P probably damaging Het
Ric8b T C 10: 84,980,175 V430A probably damaging Het
Sept10 A T 10: 59,177,003 N264K possibly damaging Het
Sgms1 A T 19: 32,159,709 F152L probably benign Het
Snapc1 C A 12: 73,964,732 F57L probably damaging Het
Spidr A G 16: 15,968,676 L401P probably damaging Het
Spn C T 7: 127,136,556 V260M probably damaging Het
Sptan1 G A 2: 30,026,584 A2095T probably damaging Het
Ssfa2 A G 2: 79,644,864 Q389R probably benign Het
Tbc1d15 A G 10: 115,202,502 probably null Het
Thsd7b T A 1: 129,678,053 F510L probably benign Het
Trpm5 T A 7: 143,078,313 I920F probably damaging Het
Tspear C A 10: 77,875,064 H507N probably benign Het
Vmn2r108 T A 17: 20,462,933 K670* probably null Het
Vmn2r75 A T 7: 86,148,477 C709* probably null Het
Wdfy3 G T 5: 101,872,901 S2494R probably benign Het
Zfp456 A T 13: 67,366,989 F199L probably damaging Het
Zfp830 A G 11: 82,764,703 Q111R probably benign Het
Znrf1 G A 8: 111,537,210 A24T probably damaging Het
Other mutations in Fmnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Fmnl1 APN 11 103197340 nonsense probably null
IGL00972:Fmnl1 APN 11 103180955 missense probably damaging 1.00
IGL01406:Fmnl1 APN 11 103194690 unclassified probably benign
IGL01417:Fmnl1 APN 11 103196694 unclassified probably benign
IGL01599:Fmnl1 APN 11 103186656 missense probably damaging 1.00
IGL02151:Fmnl1 APN 11 103192772 missense probably benign 0.38
IGL02324:Fmnl1 APN 11 103179538 missense probably damaging 1.00
IGL02812:Fmnl1 APN 11 103196766 unclassified probably benign
IGL03369:Fmnl1 APN 11 103197182 splice site probably null
archetypal UTSW 11 103186627 missense probably damaging 1.00
contractual UTSW 11 103180915 missense probably damaging 1.00
stylistic UTSW 11 103193736 critical splice donor site probably null
R0077:Fmnl1 UTSW 11 103189969 missense probably damaging 1.00
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0413:Fmnl1 UTSW 11 103194063 splice site probably benign
R1170:Fmnl1 UTSW 11 103197370 missense probably benign 0.02
R1389:Fmnl1 UTSW 11 103186709 splice site probably null
R1794:Fmnl1 UTSW 11 103197147 missense probably benign 0.00
R2082:Fmnl1 UTSW 11 103192025 missense probably damaging 1.00
R2105:Fmnl1 UTSW 11 103194692 missense probably benign 0.39
R3611:Fmnl1 UTSW 11 103194765 unclassified probably benign
R3883:Fmnl1 UTSW 11 103182114 missense probably damaging 1.00
R3893:Fmnl1 UTSW 11 103196757 unclassified probably benign
R4658:Fmnl1 UTSW 11 103197694 missense probably damaging 1.00
R4689:Fmnl1 UTSW 11 103193736 critical splice donor site probably null
R4812:Fmnl1 UTSW 11 103198564 unclassified probably benign
R4996:Fmnl1 UTSW 11 103182656 missense possibly damaging 0.58
R5646:Fmnl1 UTSW 11 103196512 unclassified probably benign
R5702:Fmnl1 UTSW 11 103185665 missense probably damaging 1.00
R5850:Fmnl1 UTSW 11 103195285 unclassified probably benign
R5903:Fmnl1 UTSW 11 103171444 splice site probably null
R6254:Fmnl1 UTSW 11 103196315 unclassified probably benign
R6958:Fmnl1 UTSW 11 103171314 start codon destroyed probably null 1.00
R7030:Fmnl1 UTSW 11 103194774 unclassified probably benign
R7133:Fmnl1 UTSW 11 103181784 critical splice donor site probably null
R7171:Fmnl1 UTSW 11 103190398 missense probably damaging 1.00
R7224:Fmnl1 UTSW 11 103182769 critical splice donor site probably null
R7282:Fmnl1 UTSW 11 103196265 missense unknown
R7448:Fmnl1 UTSW 11 103186627 missense probably damaging 1.00
R7463:Fmnl1 UTSW 11 103193128 missense probably damaging 1.00
R7831:Fmnl1 UTSW 11 103198173 missense unknown
R7862:Fmnl1 UTSW 11 103180930 missense probably damaging 1.00
R7973:Fmnl1 UTSW 11 103171158 start gained probably benign
R8177:Fmnl1 UTSW 11 103189959 missense probably damaging 0.98
R8273:Fmnl1 UTSW 11 103186699 missense probably damaging 1.00
R8345:Fmnl1 UTSW 11 103186614 missense possibly damaging 0.88
R8921:Fmnl1 UTSW 11 103197141 missense unknown
R8946:Fmnl1 UTSW 11 103180915 missense probably damaging 1.00
R8968:Fmnl1 UTSW 11 103186618 small deletion probably benign
R9114:Fmnl1 UTSW 11 103196501 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCCTCTCCACTGAAGAGTC -3'
(R):5'- GATACTGCCTTCTCCTGTCAAG -3'

Sequencing Primer
(F):5'- CCACTGAAGAGTCTCTATTGCC -3'
(R):5'- TCAAGGCTTGGAGTCTAGCTAAC -3'
Posted On 2020-10-20