Incidental Mutation 'R8507:Snapc1'
ID655656
Institutional Source Beutler Lab
Gene Symbol Snapc1
Ensembl Gene ENSMUSG00000021113
Gene Namesmall nuclear RNA activating complex, polypeptide 1
Synonyms2700033G17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8507 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location73964481-73988966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73964732 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 57 (F57L)
Ref Sequence ENSEMBL: ENSMUSP00000021532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021532] [ENSMUST00000222025]
Predicted Effect probably damaging
Transcript: ENSMUST00000021532
AA Change: F57L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021532
Gene: ENSMUSG00000021113
AA Change: F57L

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:SNAPc_SNAP43 26 210 4.5e-65 PFAM
low complexity region 261 273 N/A INTRINSIC
low complexity region 307 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221833
Predicted Effect unknown
Transcript: ENSMUST00000222025
AA Change: F57L
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 A G 14: 68,526,324 C126R probably damaging Het
Agpat5 G A 8: 18,878,027 V203I possibly damaging Het
Ankrd12 T A 17: 65,986,909 R510* probably null Het
Anxa6 C T 11: 55,013,870 A22T probably benign Het
Barx2 A T 9: 31,859,013 L73Q probably damaging Het
BC024139 T C 15: 76,120,133 K702R possibly damaging Het
Cc2d1a T C 8: 84,134,976 K739R probably benign Het
Cdk12 A G 11: 98,250,285 T1451A unknown Het
Chd7 A G 4: 8,858,675 E2367G probably damaging Het
Cp A G 3: 19,971,029 Y384C probably damaging Het
Dnah14 T A 1: 181,641,414 W1270R probably benign Het
Dyrk2 G T 10: 118,860,662 S230R probably damaging Het
Epn3 A T 11: 94,493,776 S290R probably damaging Het
Fas C T 19: 34,327,226 R296C probably benign Het
Fmnl1 A T 11: 103,194,033 N659I unknown Het
Gas8 T C 8: 123,531,038 probably null Het
Gpr156 A G 16: 37,948,236 T40A probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Htr3b C A 9: 48,964,877 probably benign Het
Itgal C T 7: 127,329,435 T1044I probably benign Het
Kcnip4 T G 5: 48,482,655 D38A possibly damaging Het
Kcnma1 G T 14: 23,591,638 Q216K probably benign Het
Kdsr T A 1: 106,743,670 E203V probably null Het
Lrp1b T C 2: 41,408,375 E999G Het
Malt1 T A 18: 65,470,523 W577R probably damaging Het
Mroh2b A C 15: 4,949,090 T1373P probably damaging Het
Mymk A G 2: 27,062,700 probably null Het
Myo1f T A 17: 33,598,018 H707Q probably benign Het
Ncam2 C A 16: 81,512,979 H452Q possibly damaging Het
Ndrg4 A G 8: 95,678,347 M1V probably null Het
Nps C T 7: 135,272,350 S83L probably damaging Het
Nup155 T A 15: 8,147,560 Y1040* probably null Het
Olfr1303 T C 2: 111,814,706 T7A probably benign Het
Olfr190 C T 16: 59,074,880 V67M possibly damaging Het
Olfr316 C T 11: 58,758,159 Q165* probably null Het
Olfr344 T C 2: 36,569,431 Y278H probably damaging Het
Pak1ip1 G A 13: 41,009,294 R191Q probably benign Het
Pcdh17 G A 14: 84,445,944 probably benign Het
Pcdhgc5 G T 18: 37,819,892 R73L probably benign Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Plxnd1 A T 6: 115,966,905 N1144K probably damaging Het
Ppp1r1b G T 11: 98,355,484 E133D probably damaging Het
Ptpn13 A G 5: 103,557,949 E1396G probably damaging Het
Reps1 T C 10: 18,094,470 S272P probably damaging Het
Ric8b T C 10: 84,980,175 V430A probably damaging Het
Sept10 A T 10: 59,177,003 N264K possibly damaging Het
Sgms1 A T 19: 32,159,709 F152L probably benign Het
Spidr A G 16: 15,968,676 L401P probably damaging Het
Spn C T 7: 127,136,556 V260M probably damaging Het
Sptan1 G A 2: 30,026,584 A2095T probably damaging Het
Ssfa2 A G 2: 79,644,864 Q389R probably benign Het
Tbc1d15 A G 10: 115,202,502 probably null Het
Thsd7b T A 1: 129,678,053 F510L probably benign Het
Trpm5 T A 7: 143,078,313 I920F probably damaging Het
Tspear C A 10: 77,875,064 H507N probably benign Het
Vmn2r108 T A 17: 20,462,933 K670* probably null Het
Vmn2r75 A T 7: 86,148,477 C709* probably null Het
Wdfy3 G T 5: 101,872,901 S2494R probably benign Het
Zfp456 A T 13: 67,366,989 F199L probably damaging Het
Zfp830 A G 11: 82,764,703 Q111R probably benign Het
Znrf1 G A 8: 111,537,210 A24T probably damaging Het
Other mutations in Snapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Snapc1 APN 12 73968374 splice site probably null
IGL00529:Snapc1 APN 12 73964655 missense probably benign 0.00
IGL00676:Snapc1 APN 12 73971913 missense probably damaging 1.00
IGL01373:Snapc1 APN 12 73964680 missense probably benign 0.00
IGL02060:Snapc1 APN 12 73968036 missense probably damaging 1.00
IGL02309:Snapc1 APN 12 73968027 missense probably damaging 1.00
IGL02653:Snapc1 APN 12 73982487 missense probably benign 0.00
IGL02686:Snapc1 APN 12 73964596 intron probably benign
IGL03160:Snapc1 APN 12 73970204 missense probably damaging 1.00
PIT4362001:Snapc1 UTSW 12 73982495 missense probably damaging 0.98
R0056:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0057:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0057:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0113:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0152:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0153:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0244:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0245:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0316:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0318:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0352:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0646:Snapc1 UTSW 12 73975032 missense probably damaging 1.00
R0841:Snapc1 UTSW 12 73975006 splice site probably benign
R2188:Snapc1 UTSW 12 73970227 missense probably damaging 1.00
R2483:Snapc1 UTSW 12 73964643 missense probably benign 0.02
R4165:Snapc1 UTSW 12 73982580 critical splice donor site probably null
R4169:Snapc1 UTSW 12 73982491 missense probably benign 0.00
R4549:Snapc1 UTSW 12 73970279 missense probably damaging 0.97
R4550:Snapc1 UTSW 12 73970279 missense probably damaging 0.97
R4658:Snapc1 UTSW 12 73983868 missense possibly damaging 0.75
R6976:Snapc1 UTSW 12 73970200 missense probably damaging 1.00
R7432:Snapc1 UTSW 12 73968294 missense probably benign 0.01
R7488:Snapc1 UTSW 12 73982511 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CACCTTGCATTTACGCACGC -3'
(R):5'- CAAGATTGGAGGAGGTTTGGCC -3'

Sequencing Primer
(F):5'- CTTGAGGTCCCGGATAGTACGTC -3'
(R):5'- AGGTTTGGCCTCGGATGGAG -3'
Posted On2020-10-20