Incidental Mutation 'R8507:Myo1f'
ID655670
Institutional Source Beutler Lab
Gene Symbol Myo1f
Ensembl Gene ENSMUSG00000024300
Gene Namemyosin IF
SynonymsC330006B10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R8507 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location33555719-33607764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33598018 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 707 (H707Q)
Ref Sequence ENSEMBL: ENSMUSP00000084887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087605] [ENSMUST00000173372]
Predicted Effect probably benign
Transcript: ENSMUST00000087605
AA Change: H707Q

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000084887
Gene: ENSMUSG00000024300
AA Change: H707Q

DomainStartEndE-ValueType
MYSc 11 691 N/A SMART
IQ 692 714 7.57e0 SMART
Pfam:Myosin_TH1 717 909 1.7e-51 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 973 987 N/A INTRINSIC
low complexity region 991 1001 N/A INTRINSIC
SH3 1044 1098 2.09e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173372
AA Change: H707Q

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134715
Gene: ENSMUSG00000024300
AA Change: H707Q

DomainStartEndE-ValueType
MYSc 11 691 N/A SMART
IQ 692 714 7.57e0 SMART
Pfam:Myosin_TH1 716 780 6e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are molecular motors that use the energy from ATP hydrolysis to generate force on actin filaments. The protein encoded by this gene is an unconventional myosin that may be involved in the intracellular movement of membrane-enclosed compartments. There is evidence to suggest that mutations in this gene can result in hearing loss. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired neutrophil migration and adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 A G 14: 68,526,324 C126R probably damaging Het
Agpat5 G A 8: 18,878,027 V203I possibly damaging Het
Ankrd12 T A 17: 65,986,909 R510* probably null Het
Anxa6 C T 11: 55,013,870 A22T probably benign Het
Barx2 A T 9: 31,859,013 L73Q probably damaging Het
BC024139 T C 15: 76,120,133 K702R possibly damaging Het
Cc2d1a T C 8: 84,134,976 K739R probably benign Het
Cdk12 A G 11: 98,250,285 T1451A unknown Het
Chd7 A G 4: 8,858,675 E2367G probably damaging Het
Cp A G 3: 19,971,029 Y384C probably damaging Het
Dnah14 T A 1: 181,641,414 W1270R probably benign Het
Dyrk2 G T 10: 118,860,662 S230R probably damaging Het
Epn3 A T 11: 94,493,776 S290R probably damaging Het
Fas C T 19: 34,327,226 R296C probably benign Het
Fmnl1 A T 11: 103,194,033 N659I unknown Het
Gas8 T C 8: 123,531,038 probably null Het
Gpr156 A G 16: 37,948,236 T40A probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Htr3b C A 9: 48,964,877 probably benign Het
Itgal C T 7: 127,329,435 T1044I probably benign Het
Kcnip4 T G 5: 48,482,655 D38A possibly damaging Het
Kcnma1 G T 14: 23,591,638 Q216K probably benign Het
Kdsr T A 1: 106,743,670 E203V probably null Het
Lrp1b T C 2: 41,408,375 E999G Het
Malt1 T A 18: 65,470,523 W577R probably damaging Het
Mroh2b A C 15: 4,949,090 T1373P probably damaging Het
Mymk A G 2: 27,062,700 probably null Het
Ncam2 C A 16: 81,512,979 H452Q possibly damaging Het
Ndrg4 A G 8: 95,678,347 M1V probably null Het
Nps C T 7: 135,272,350 S83L probably damaging Het
Nup155 T A 15: 8,147,560 Y1040* probably null Het
Olfr1303 T C 2: 111,814,706 T7A probably benign Het
Olfr190 C T 16: 59,074,880 V67M possibly damaging Het
Olfr316 C T 11: 58,758,159 Q165* probably null Het
Olfr344 T C 2: 36,569,431 Y278H probably damaging Het
Pak1ip1 G A 13: 41,009,294 R191Q probably benign Het
Pcdh17 G A 14: 84,445,944 probably benign Het
Pcdhgc5 G T 18: 37,819,892 R73L probably benign Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Plxnd1 A T 6: 115,966,905 N1144K probably damaging Het
Ppp1r1b G T 11: 98,355,484 E133D probably damaging Het
Ptpn13 A G 5: 103,557,949 E1396G probably damaging Het
Reps1 T C 10: 18,094,470 S272P probably damaging Het
Ric8b T C 10: 84,980,175 V430A probably damaging Het
Sept10 A T 10: 59,177,003 N264K possibly damaging Het
Sgms1 A T 19: 32,159,709 F152L probably benign Het
Snapc1 C A 12: 73,964,732 F57L probably damaging Het
Spidr A G 16: 15,968,676 L401P probably damaging Het
Spn C T 7: 127,136,556 V260M probably damaging Het
Sptan1 G A 2: 30,026,584 A2095T probably damaging Het
Ssfa2 A G 2: 79,644,864 Q389R probably benign Het
Tbc1d15 A G 10: 115,202,502 probably null Het
Thsd7b T A 1: 129,678,053 F510L probably benign Het
Trpm5 T A 7: 143,078,313 I920F probably damaging Het
Tspear C A 10: 77,875,064 H507N probably benign Het
Vmn2r108 T A 17: 20,462,933 K670* probably null Het
Vmn2r75 A T 7: 86,148,477 C709* probably null Het
Wdfy3 G T 5: 101,872,901 S2494R probably benign Het
Zfp456 A T 13: 67,366,989 F199L probably damaging Het
Zfp830 A G 11: 82,764,703 Q111R probably benign Het
Znrf1 G A 8: 111,537,210 A24T probably damaging Het
Other mutations in Myo1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Myo1f APN 17 33581964 missense probably benign 0.01
IGL01019:Myo1f APN 17 33593003 missense possibly damaging 0.93
IGL01524:Myo1f APN 17 33579883 missense probably damaging 1.00
IGL01744:Myo1f APN 17 33583680 splice site probably benign
IGL01951:Myo1f APN 17 33598017 missense possibly damaging 0.64
IGL02132:Myo1f APN 17 33579971 missense probably benign 0.10
IGL02170:Myo1f APN 17 33578272 missense probably benign 0.14
IGL02173:Myo1f APN 17 33607344 missense probably damaging 1.00
IGL02277:Myo1f APN 17 33579861 splice site probably null
IGL02550:Myo1f APN 17 33588142 missense probably damaging 1.00
IGL02550:Myo1f APN 17 33580150 unclassified probably benign
IGL02615:Myo1f APN 17 33604656 missense probably benign
IGL02801:Myo1f APN 17 33578137 missense probably damaging 1.00
IGL02817:Myo1f APN 17 33604558 missense probably benign 0.06
IGL02904:Myo1f APN 17 33585658 nonsense probably null
IGL03056:Myo1f APN 17 33585600 missense probably damaging 1.00
IGL03334:Myo1f APN 17 33598194 missense probably damaging 1.00
R0066:Myo1f UTSW 17 33601703 missense probably damaging 0.98
R0066:Myo1f UTSW 17 33601703 missense probably damaging 0.98
R0321:Myo1f UTSW 17 33593012 missense probably benign 0.31
R0375:Myo1f UTSW 17 33601956 missense probably benign 0.27
R0487:Myo1f UTSW 17 33578284 missense probably damaging 1.00
R0925:Myo1f UTSW 17 33578133 missense probably damaging 0.96
R1394:Myo1f UTSW 17 33583740 missense probably damaging 0.96
R1395:Myo1f UTSW 17 33583740 missense probably damaging 0.96
R1474:Myo1f UTSW 17 33594027 missense possibly damaging 0.77
R1760:Myo1f UTSW 17 33586198 missense probably benign 0.03
R1965:Myo1f UTSW 17 33598172 nonsense probably null
R2409:Myo1f UTSW 17 33576667 missense probably damaging 1.00
R2432:Myo1f UTSW 17 33575849 missense probably damaging 1.00
R4610:Myo1f UTSW 17 33582332 missense probably damaging 1.00
R4785:Myo1f UTSW 17 33598191 missense possibly damaging 0.95
R5239:Myo1f UTSW 17 33601735 missense probably benign 0.00
R5881:Myo1f UTSW 17 33576653 missense probably damaging 1.00
R5881:Myo1f UTSW 17 33580285 missense possibly damaging 0.46
R6160:Myo1f UTSW 17 33604344 missense probably benign
R6210:Myo1f UTSW 17 33601070 missense probably damaging 1.00
R6365:Myo1f UTSW 17 33586116 missense probably benign
R6464:Myo1f UTSW 17 33576647 missense probably damaging 1.00
R6532:Myo1f UTSW 17 33575846 missense probably damaging 1.00
R6678:Myo1f UTSW 17 33575845 missense probably damaging 1.00
R7241:Myo1f UTSW 17 33579928 missense probably damaging 0.99
R7266:Myo1f UTSW 17 33601694 missense probably benign
R7513:Myo1f UTSW 17 33575814 missense probably damaging 1.00
R7606:Myo1f UTSW 17 33576450 missense probably damaging 1.00
R7779:Myo1f UTSW 17 33578273 missense probably benign 0.27
R7853:Myo1f UTSW 17 33576698 missense probably damaging 1.00
R7884:Myo1f UTSW 17 33598296 missense probably damaging 1.00
X0028:Myo1f UTSW 17 33576438 missense possibly damaging 0.67
X0065:Myo1f UTSW 17 33601983 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTGTGGGTGCAGTCATGAAG -3'
(R):5'- ACGGTTGATGCTGTTTCGCC -3'

Sequencing Primer
(F):5'- GATAGAGTGCTTGCCTAGTACACAC -3'
(R):5'- CTTCGTTCCTTCTTGTTCAGTAGG -3'
Posted On2020-10-20