Mutagenetix > Incidental Mutations

Incidental Mutation 'R8508:Arhgap21'

655678

Institutional Source

Beutler Lab

Gene Symbol

Arhgap21

Ensembl Gene

ENSMUSG00000036591

Gene Name

Rho GTPase activating protein 21

Synonyms

ARHGAP10, 5530401C11Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.361) question?

Stock #

R8508 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20847919-20968881 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20854180 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 1234 (M1234I)

Ref Sequence

ENSEMBL: ENSMUSP00000133347 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000173784] [ENSMUST00000174584]

Predicted Effect

probably benign
Transcript: ENSMUST00000114594

SMART Domains

Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591

Domain	Start	End	E-Value	Type
PDZ	58	159	1.03e-16	SMART
low complexity region	351	362	N/A	INTRINSIC
low complexity region	445	459	N/A	INTRINSIC
low complexity region	625	635	N/A	INTRINSIC
low complexity region	911	925	N/A	INTRINSIC
PH	930	1040	2.09e-16	SMART
RhoGAP	1157	1334	3.26e-62	SMART
low complexity region	1381	1399	N/A	INTRINSIC
low complexity region	1448	1466	N/A	INTRINSIC
low complexity region	1533	1565	N/A	INTRINSIC
low complexity region	1573	1593	N/A	INTRINSIC
low complexity region	1891	1900	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141298

SMART Domains

Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000154230

SMART Domains

Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173194

SMART Domains

Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	347	358	N/A	INTRINSIC
low complexity region	441	455	N/A	INTRINSIC
low complexity region	621	631	N/A	INTRINSIC
low complexity region	907	921	N/A	INTRINSIC
PH	926	1036	2.09e-16	SMART
RhoGAP	1153	1330	3.26e-62	SMART
low complexity region	1377	1395	N/A	INTRINSIC
low complexity region	1444	1462	N/A	INTRINSIC
low complexity region	1529	1561	N/A	INTRINSIC
low complexity region	1569	1589	N/A	INTRINSIC
low complexity region	1887	1896	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173784

SMART Domains

Protein: ENSMUSP00000133539
Gene: ENSMUSG00000036591

Domain	Start	End	E-Value	Type
low complexity region	21	35	N/A	INTRINSIC
PH	40	150	2.09e-16	SMART
RhoGAP	268	395	1.55e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174584
AA Change: M1234I

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591
AA Change: M1234I

Domain	Start	End	E-Value	Type
low complexity region	186	197	N/A	INTRINSIC
low complexity region	280	294	N/A	INTRINSIC
low complexity region	460	470	N/A	INTRINSIC
low complexity region	746	760	N/A	INTRINSIC
PH	765	875	2.09e-16	SMART
RhoGAP	992	1169	3.26e-62	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,743,598	L136P	probably benign	Het
4932438H23Rik	T	G	16: 91,055,612	Y212S	probably damaging	Het
Angpt1	T	C	15: 42,512,399	N154D	probably damaging	Het
Angpt2	G	A	8: 18,741,119	R54*	probably null	Het
Ankrd27	T	A	7: 35,601,626	L117*	probably null	Het
Arhgef33	A	G	17: 80,367,335	E387G	probably damaging	Het
Atp13a4	T	A	16: 29,454,769	K444*	probably null	Het
Atp6v1a	G	A	16: 44,101,862	R338C	probably damaging	Het
Canx	T	C	11: 50,311,647	D44G	possibly damaging	Het
Ccdc141	T	A	2: 77,132,244	M119L	probably benign	Het
Ckmt1	A	C	2: 121,362,691	Q299P	possibly damaging	Het
Dhx16	T	C	17: 35,885,920	S601P	probably damaging	Het
Dna2	A	C	10: 62,950,894	R140S	probably damaging	Het
Dock1	A	G	7: 134,782,409	T670A	probably benign	Het
Eogt	A	G	6: 97,143,998	S85P	possibly damaging	Het
Fbf1	A	T	11: 116,165,881	M1K	probably null	Het
Fbxl12	C	A	9: 20,638,864	R165L	possibly damaging	Het
Flnb	G	A	14: 7,950,394	V2571I	probably damaging	Het
Gm11361	A	G	13: 28,257,711	I26V	probably benign	Het
Gm43518	A	G	5: 123,938,259	E123G	unknown	Het
Gm8332	T	G	12: 88,249,685	E139A	unknown	Het
Gpatch2	A	G	1: 187,304,355	N374S	probably benign	Het
Hey1	G	C	3: 8,664,776	A207G	probably benign	Het
Hoxa11	T	C	6: 52,245,802		probably benign	Het
Hydin	G	A	8: 110,582,018	V3979I	probably benign	Het
Ighe	C	T	12: 113,271,793	W277*	probably null	Het
Kmt2c	G	T	5: 25,314,122	T2330K	probably benign	Het
Krt6a	T	A	15: 101,692,735	K261M	probably damaging	Het
Lats2	A	C	14: 57,722,705	S161A	probably benign	Het
Med13l	T	A	5: 118,754,321	D1936E	probably benign	Het
Mipol1	T	C	12: 57,306,088	V71A	possibly damaging	Het
Mphosph8	A	T	14: 56,676,546	K415*	probably null	Het
Npepps	A	G	11: 97,244,426		probably null	Het
Ntn4	A	T	10: 93,741,104	N545Y	possibly damaging	Het
Olfr1501	A	T	19: 13,838,402	M257K	possibly damaging	Het
Olfr164	T	C	16: 19,286,701	D14G	probably benign	Het
Olfr353	A	G	2: 36,890,354	S165P	probably damaging	Het
Olfr738	A	C	14: 50,413,675	M44L	probably benign	Het
Osbpl2	T	A	2: 180,155,343	V358E	possibly damaging	Het
Pdcd11	C	A	19: 47,119,806	P1204Q	probably damaging	Het
Pnliprp2	A	C	19: 58,763,374	S184R	probably damaging	Het
Ppm1g	G	T	5: 31,204,528	R373S	probably damaging	Het
Rnf130	A	G	11: 50,087,437	D275G	probably damaging	Het
Setd5	T	C	6: 113,121,087	S696P	probably damaging	Het
Sgip1	A	G	4: 102,915,071	Q219R	probably benign	Het
Slc1a2	T	C	2: 102,736,085		probably null	Het
Slc22a12	T	C	19: 6,542,437	T106A	probably benign	Het
Slc22a14	A	G	9: 119,180,585	L148P	probably damaging	Het
Slc2a9	A	T	5: 38,382,078	F375I	probably damaging	Het
Sorbs3	A	T	14: 70,202,947	D117E	probably benign	Het
Sphkap	G	A	1: 83,276,500	T1176I	probably damaging	Het
Supt16	A	T	14: 52,181,589	V193D	probably damaging	Het
Sytl3	A	G	17: 6,728,291	T362A	probably damaging	Het
Tctn1	T	A	5: 122,246,611	Q410L	probably benign	Het
Trbc2	T	C	6: 41,547,777	Y133H		Het
Ttc28	G	A	5: 111,233,341	D1240N	probably benign	Het
Vmn2r120	A	G	17: 57,525,843	V112A	probably benign	Het
Zfp354b	A	T	11: 50,923,470	S209R	probably benign	Het
Zfp362	T	C	4: 128,774,606	H391R	probably damaging	Het

Other mutations in Arhgap21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Arhgap21	APN	2	20855700	missense	probably damaging	1.00
IGL01472:Arhgap21	APN	2	20849581	missense	probably damaging	1.00
IGL01634:Arhgap21	APN	2	20914644	missense	probably benign	0.00
IGL01766:Arhgap21	APN	2	20849637	missense	possibly damaging	0.68
IGL02097:Arhgap21	APN	2	20880002	missense	probably benign	0.39
IGL02197:Arhgap21	APN	2	20880306	missense	probably benign
IGL02264:Arhgap21	APN	2	20860039	splice site	probably null
IGL02346:Arhgap21	APN	2	20879951	splice site	probably benign
IGL02418:Arhgap21	APN	2	20880900	missense	probably damaging	1.00
IGL02605:Arhgap21	APN	2	20855588	missense	probably damaging	1.00
IGL02701:Arhgap21	APN	2	20892091	missense	probably damaging	1.00
IGL03019:Arhgap21	APN	2	20861063	missense	probably damaging	1.00
IGL03085:Arhgap21	APN	2	20914721	missense	probably benign
IGL03265:Arhgap21	APN	2	20849628	missense	probably benign	0.03
IGL03379:Arhgap21	APN	2	20880689	missense	probably benign	0.41
R0304:Arhgap21	UTSW	2	20859801	splice site	probably benign
R0363:Arhgap21	UTSW	2	20881133	missense	probably damaging	1.00
R0498:Arhgap21	UTSW	2	20863117	missense	probably damaging	1.00
R0539:Arhgap21	UTSW	2	20914799	nonsense	probably null
R0633:Arhgap21	UTSW	2	20855387	nonsense	probably null
R0905:Arhgap21	UTSW	2	20849934	missense	possibly damaging	0.88
R1550:Arhgap21	UTSW	2	20881765	nonsense	probably null
R1570:Arhgap21	UTSW	2	20880840	missense	probably benign
R1686:Arhgap21	UTSW	2	20881848	missense	probably damaging	1.00
R1746:Arhgap21	UTSW	2	20861099	missense	probably damaging	0.99
R1864:Arhgap21	UTSW	2	20861204	missense	probably damaging	1.00
R1865:Arhgap21	UTSW	2	20861204	missense	probably damaging	1.00
R2209:Arhgap21	UTSW	2	20849520	missense	probably damaging	1.00
R2211:Arhgap21	UTSW	2	20881640	missense	possibly damaging	0.56
R2276:Arhgap21	UTSW	2	20863226	missense	possibly damaging	0.94
R2277:Arhgap21	UTSW	2	20863226	missense	possibly damaging	0.94
R2279:Arhgap21	UTSW	2	20863226	missense	possibly damaging	0.94
R2336:Arhgap21	UTSW	2	20880051	missense	probably damaging	1.00
R2516:Arhgap21	UTSW	2	20854998	missense	probably damaging	1.00
R3722:Arhgap21	UTSW	2	20850291	missense	probably damaging	1.00
R3877:Arhgap21	UTSW	2	20859906	missense	probably damaging	0.99
R4017:Arhgap21	UTSW	2	20892104	missense	probably benign	0.10
R4232:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4233:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4234:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4235:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4236:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4434:Arhgap21	UTSW	2	20967335	missense	probably benign
R4686:Arhgap21	UTSW	2	20863222	missense	probably damaging	1.00
R4817:Arhgap21	UTSW	2	20850156	missense	probably benign
R4834:Arhgap21	UTSW	2	20865319	missense	probably damaging	1.00
R4845:Arhgap21	UTSW	2	20881187	missense	probably damaging	0.99
R4889:Arhgap21	UTSW	2	20880468	missense	probably benign	0.10
R4904:Arhgap21	UTSW	2	20850061	missense	probably benign	0.00
R4911:Arhgap21	UTSW	2	20858989	missense	probably damaging	1.00
R4994:Arhgap21	UTSW	2	20849890	missense	probably benign	0.00
R5067:Arhgap21	UTSW	2	20880037	missense	probably damaging	1.00
R5086:Arhgap21	UTSW	2	20848834	missense	probably benign	0.00
R5281:Arhgap21	UTSW	2	20849316	missense	probably damaging	1.00
R5364:Arhgap21	UTSW	2	20849722	missense	probably damaging	1.00
R5420:Arhgap21	UTSW	2	20881086	missense	probably damaging	0.99
R5476:Arhgap21	UTSW	2	20880686	missense	probably benign	0.06
R5831:Arhgap21	UTSW	2	20863213	missense	probably damaging	1.00
R5949:Arhgap21	UTSW	2	20849041	missense	probably damaging	0.97
R5994:Arhgap21	UTSW	2	20881376	missense	possibly damaging	0.78
R6014:Arhgap21	UTSW	2	20881805	missense	probably damaging	1.00
R6739:Arhgap21	UTSW	2	20880732	missense	possibly damaging	0.94
R6817:Arhgap21	UTSW	2	20880296	missense	probably benign	0.23
R6821:Arhgap21	UTSW	2	20848848	missense	probably benign
R6844:Arhgap21	UTSW	2	20881305	missense	probably benign	0.00
R6870:Arhgap21	UTSW	2	20880510	missense	probably damaging	1.00
R6891:Arhgap21	UTSW	2	20850331	missense	probably damaging	0.97
R7011:Arhgap21	UTSW	2	20848878	missense	possibly damaging	0.65
R7144:Arhgap21	UTSW	2	20865387	missense	probably benign
R7237:Arhgap21	UTSW	2	20849972	nonsense	probably null
R7261:Arhgap21	UTSW	2	20880366	missense	probably benign
R7558:Arhgap21	UTSW	2	20855610	missense	probably damaging	1.00
R7566:Arhgap21	UTSW	2	20912291	missense	probably benign	0.17
R7738:Arhgap21	UTSW	2	20849479	missense	probably damaging	1.00
R7738:Arhgap21	UTSW	2	20850358	missense	probably damaging	1.00
R7820:Arhgap21	UTSW	2	20863172	missense	probably damaging	1.00
R7822:Arhgap21	UTSW	2	20880713	missense	possibly damaging	0.80
R7965:Arhgap21	UTSW	2	20849196	missense	probably damaging	1.00
R7986:Arhgap21	UTSW	2	20863156	missense	probably damaging	1.00
R8028:Arhgap21	UTSW	2	20880405	missense	probably benign	0.02
R8209:Arhgap21	UTSW	2	20871745	missense	probably damaging	1.00
R8226:Arhgap21	UTSW	2	20871745	missense	probably damaging	1.00
R8251:Arhgap21	UTSW	2	20849410	missense	probably benign
R8486:Arhgap21	UTSW	2	20860425	missense	probably damaging	1.00
R8487:Arhgap21	UTSW	2	20881305	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- ACCATGCTATTTCTCCTCAGGG -3'
(R):5'- TGTTGCACTAATCTGGCATGC -3'

Sequencing Primer
(F):5'- TCCTCAGGGTCTGCTTCAGAAATAAC -3'
(R):5'- GGCATGCTATTTCACACCATG -3'

Posted On

2020-10-20