Incidental Mutation 'R8508:Ccdc141'
ID655680
Institutional Source Beutler Lab
Gene Symbol Ccdc141
Ensembl Gene ENSMUSG00000044033
Gene Namecoiled-coil domain containing 141
SynonymsENSMUSG00000075261, 2610301F02Rik, CAMDI
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8508 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location77009902-77170636 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77132244 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 119 (M119L)
Ref Sequence ENSEMBL: ENSMUSP00000052945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049544] [ENSMUST00000133503] [ENSMUST00000164114]
Predicted Effect probably benign
Transcript: ENSMUST00000049544
AA Change: M119L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000052945
Gene: ENSMUSG00000044033
AA Change: M119L

DomainStartEndE-ValueType
SPEC 26 128 2.87e-1 SMART
Blast:SPEC 132 222 1e-40 BLAST
low complexity region 223 251 N/A INTRINSIC
SPEC 252 353 3.61e-1 SMART
Blast:SPEC 356 453 2e-49 BLAST
Blast:SPEC 461 562 1e-16 BLAST
low complexity region 569 583 N/A INTRINSIC
Blast:SPEC 688 772 7e-30 BLAST
low complexity region 773 785 N/A INTRINSIC
Blast:SPEC 790 894 2e-24 BLAST
Blast:SPEC 907 1009 4e-44 BLAST
Blast:SPEC 1012 1118 9e-63 BLAST
low complexity region 1203 1231 N/A INTRINSIC
Blast:IG 1305 1416 5e-54 BLAST
SCOP:d1g1ca_ 1406 1443 1e-9 SMART
Blast:IG 1416 1444 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000133503
SMART Domains Protein: ENSMUSP00000120312
Gene: ENSMUSG00000044033

DomainStartEndE-ValueType
Blast:SPEC 26 60 4e-17 BLAST
low complexity region 61 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164114
AA Change: M119L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000128736
Gene: ENSMUSG00000044033
AA Change: M119L

DomainStartEndE-ValueType
SPEC 26 128 2.87e-1 SMART
Blast:SPEC 132 222 2e-40 BLAST
low complexity region 223 251 N/A INTRINSIC
SPEC 252 353 3.61e-1 SMART
Blast:SPEC 356 453 2e-49 BLAST
Blast:SPEC 461 562 1e-16 BLAST
low complexity region 569 583 N/A INTRINSIC
Blast:SPEC 688 772 7e-30 BLAST
low complexity region 773 785 N/A INTRINSIC
Blast:SPEC 790 894 3e-24 BLAST
Blast:SPEC 907 1009 4e-44 BLAST
Blast:SPEC 1012 1118 1e-62 BLAST
low complexity region 1203 1231 N/A INTRINSIC
IGc2 1422 1489 1.27e-5 SMART
transmembrane domain 1510 1529 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout impairs migration of neurons in the somatosensory cortex, resulting in increased anxiety and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,598 L136P probably benign Het
4932438H23Rik T G 16: 91,055,612 Y212S probably damaging Het
Angpt1 T C 15: 42,512,399 N154D probably damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Ankrd27 T A 7: 35,601,626 L117* probably null Het
Arhgap21 C T 2: 20,854,180 M1234I probably benign Het
Arhgef33 A G 17: 80,367,335 E387G probably damaging Het
Atp13a4 T A 16: 29,454,769 K444* probably null Het
Atp6v1a G A 16: 44,101,862 R338C probably damaging Het
Canx T C 11: 50,311,647 D44G possibly damaging Het
Ckmt1 A C 2: 121,362,691 Q299P possibly damaging Het
Dhx16 T C 17: 35,885,920 S601P probably damaging Het
Dna2 A C 10: 62,950,894 R140S probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Eogt A G 6: 97,143,998 S85P possibly damaging Het
Fbf1 A T 11: 116,165,881 M1K probably null Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flnb G A 14: 7,950,394 V2571I probably damaging Het
Gm11361 A G 13: 28,257,711 I26V probably benign Het
Gm43518 A G 5: 123,938,259 E123G unknown Het
Gm8332 T G 12: 88,249,685 E139A unknown Het
Gpatch2 A G 1: 187,304,355 N374S probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Hoxa11 T C 6: 52,245,802 probably benign Het
Hydin G A 8: 110,582,018 V3979I probably benign Het
Ighe C T 12: 113,271,793 W277* probably null Het
Kmt2c G T 5: 25,314,122 T2330K probably benign Het
Krt6a T A 15: 101,692,735 K261M probably damaging Het
Lats2 A C 14: 57,722,705 S161A probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Npepps A G 11: 97,244,426 probably null Het
Ntn4 A T 10: 93,741,104 N545Y possibly damaging Het
Olfr1501 A T 19: 13,838,402 M257K possibly damaging Het
Olfr164 T C 16: 19,286,701 D14G probably benign Het
Olfr353 A G 2: 36,890,354 S165P probably damaging Het
Olfr738 A C 14: 50,413,675 M44L probably benign Het
Osbpl2 T A 2: 180,155,343 V358E possibly damaging Het
Pdcd11 C A 19: 47,119,806 P1204Q probably damaging Het
Pnliprp2 A C 19: 58,763,374 S184R probably damaging Het
Ppm1g G T 5: 31,204,528 R373S probably damaging Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Setd5 T C 6: 113,121,087 S696P probably damaging Het
Sgip1 A G 4: 102,915,071 Q219R probably benign Het
Slc1a2 T C 2: 102,736,085 probably null Het
Slc22a12 T C 19: 6,542,437 T106A probably benign Het
Slc22a14 A G 9: 119,180,585 L148P probably damaging Het
Slc2a9 A T 5: 38,382,078 F375I probably damaging Het
Sorbs3 A T 14: 70,202,947 D117E probably benign Het
Sphkap G A 1: 83,276,500 T1176I probably damaging Het
Supt16 A T 14: 52,181,589 V193D probably damaging Het
Sytl3 A G 17: 6,728,291 T362A probably damaging Het
Tctn1 T A 5: 122,246,611 Q410L probably benign Het
Trbc2 T C 6: 41,547,777 Y133H Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r120 A G 17: 57,525,843 V112A probably benign Het
Zfp354b A T 11: 50,923,470 S209R probably benign Het
Zfp362 T C 4: 128,774,606 H391R probably damaging Het
Other mutations in Ccdc141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Ccdc141 APN 2 77054644 missense probably damaging 0.98
IGL01396:Ccdc141 APN 2 77128325 missense possibly damaging 0.87
IGL01408:Ccdc141 APN 2 77045679 missense probably benign 0.01
IGL01633:Ccdc141 APN 2 77089249 missense probably benign 0.01
IGL01982:Ccdc141 APN 2 77030659 missense probably damaging 1.00
IGL02105:Ccdc141 APN 2 77049577 critical splice donor site probably null
IGL02307:Ccdc141 APN 2 77029342 missense probably damaging 1.00
IGL02645:Ccdc141 APN 2 77074867 nonsense probably null
IGL02737:Ccdc141 APN 2 77057924 missense probably damaging 0.97
IGL02740:Ccdc141 APN 2 77054609 missense probably benign 0.05
IGL02949:Ccdc141 APN 2 77027594 missense probably damaging 1.00
IGL03127:Ccdc141 APN 2 77029235 critical splice donor site probably null
Verloren UTSW 2 77027648 missense probably damaging 1.00
Verschied UTSW 2 77108356 splice site probably benign
R0153:Ccdc141 UTSW 2 77165238 intron probably benign
R0384:Ccdc141 UTSW 2 77027648 missense probably damaging 1.00
R0423:Ccdc141 UTSW 2 77039450 missense probably damaging 0.96
R0573:Ccdc141 UTSW 2 77039493 missense probably benign 0.00
R1332:Ccdc141 UTSW 2 77014440 missense probably damaging 1.00
R1336:Ccdc141 UTSW 2 77014440 missense probably damaging 1.00
R1355:Ccdc141 UTSW 2 77030601 missense probably damaging 1.00
R1416:Ccdc141 UTSW 2 77014796 missense probably damaging 1.00
R1659:Ccdc141 UTSW 2 77054683 missense probably benign 0.41
R1726:Ccdc141 UTSW 2 77108356 splice site probably benign
R1799:Ccdc141 UTSW 2 77011671 missense possibly damaging 0.88
R1837:Ccdc141 UTSW 2 77011665 missense probably benign 0.00
R1839:Ccdc141 UTSW 2 77011665 missense probably benign 0.00
R1918:Ccdc141 UTSW 2 77014703 missense probably benign 0.00
R2019:Ccdc141 UTSW 2 77011565 missense probably damaging 1.00
R2133:Ccdc141 UTSW 2 77059607 missense probably benign 0.28
R2158:Ccdc141 UTSW 2 77030671 missense probably damaging 1.00
R2256:Ccdc141 UTSW 2 77132262 missense probably damaging 1.00
R2359:Ccdc141 UTSW 2 77170402 missense probably damaging 1.00
R2382:Ccdc141 UTSW 2 77011542 missense probably damaging 1.00
R2382:Ccdc141 UTSW 2 77074998 missense probably benign 0.11
R3110:Ccdc141 UTSW 2 77039486 missense probably benign 0.31
R3112:Ccdc141 UTSW 2 77039486 missense probably benign 0.31
R4334:Ccdc141 UTSW 2 77170432 missense probably damaging 1.00
R4493:Ccdc141 UTSW 2 77132297 missense probably damaging 1.00
R4494:Ccdc141 UTSW 2 77132297 missense probably damaging 1.00
R4628:Ccdc141 UTSW 2 77059680 missense probably benign 0.02
R4748:Ccdc141 UTSW 2 77057980 missense possibly damaging 0.67
R4810:Ccdc141 UTSW 2 77045755 missense possibly damaging 0.73
R4824:Ccdc141 UTSW 2 77124336 missense probably damaging 0.99
R4829:Ccdc141 UTSW 2 77074916 missense probably damaging 0.99
R4920:Ccdc141 UTSW 2 77168563 missense probably damaging 1.00
R5024:Ccdc141 UTSW 2 77054703 missense probably benign 0.17
R5073:Ccdc141 UTSW 2 77124378 splice site probably null
R5251:Ccdc141 UTSW 2 77027774 missense probably damaging 1.00
R5252:Ccdc141 UTSW 2 77132249 missense probably benign 0.03
R5534:Ccdc141 UTSW 2 77057897 missense probably benign
R5539:Ccdc141 UTSW 2 77015093 missense probably damaging 0.98
R5551:Ccdc141 UTSW 2 77014409 missense probably damaging 1.00
R5784:Ccdc141 UTSW 2 77029327 missense probably damaging 1.00
R5837:Ccdc141 UTSW 2 77108437 missense possibly damaging 0.56
R5850:Ccdc141 UTSW 2 77029403 missense probably damaging 0.98
R6050:Ccdc141 UTSW 2 77011731 missense probably benign 0.33
R6263:Ccdc141 UTSW 2 77108463 missense probably damaging 1.00
R6502:Ccdc141 UTSW 2 77170401 missense probably damaging 1.00
R6580:Ccdc141 UTSW 2 77011755 missense possibly damaging 0.50
R6865:Ccdc141 UTSW 2 77029235 critical splice donor site probably null
R7014:Ccdc141 UTSW 2 77132297 missense probably damaging 1.00
R7094:Ccdc141 UTSW 2 77041453 missense possibly damaging 0.83
R7195:Ccdc141 UTSW 2 77049583 missense probably benign 0.39
R7300:Ccdc141 UTSW 2 77014694 missense probably benign 0.00
R7654:Ccdc141 UTSW 2 77042478 missense probably benign 0.05
R7834:Ccdc141 UTSW 2 77059545 missense possibly damaging 0.81
R7868:Ccdc141 UTSW 2 77108412 missense probably damaging 0.99
R7986:Ccdc141 UTSW 2 77015117 missense probably benign 0.01
R8059:Ccdc141 UTSW 2 77044751 missense probably damaging 1.00
R8082:Ccdc141 UTSW 2 77124244 missense probably damaging 0.99
R8439:Ccdc141 UTSW 2 77059550 missense possibly damaging 0.82
Z1088:Ccdc141 UTSW 2 77128272 missense probably benign 0.03
Z1177:Ccdc141 UTSW 2 77015149 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACATGAGCATTCCCCAATAATTG -3'
(R):5'- TACACTGGATGGCAACTGATTTAC -3'

Sequencing Primer
(F):5'- TCCCCAATAATTGTATAGTGAGAGC -3'
(R):5'- CTGGATGGCAACTGATTTACATTTTC -3'
Posted On2020-10-20