Mutagenetix > Incidental Mutation

Incidental Mutation 'R8508:Slc1a2'

655681

Institutional Source

Beutler Lab

Gene Symbol

Slc1a2

Ensembl Gene

ENSMUSG00000005089

Gene Name

solute carrier family 1 (glial high affinity glutamate transporter), member 2

Synonyms

2900019G14Rik, 1700091C19Rik, MGLT1, GLT1, Eaat2, GLT-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.401) question?

Stock #

R8508 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

102658659-102790784 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 102736085 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000079100 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005220] [ENSMUST00000080210] [ENSMUST00000111212] [ENSMUST00000111213] [ENSMUST00000123759]

AlphaFold

P43006

Predicted Effect

probably benign
Transcript: ENSMUST00000005220

SMART Domains

Protein: ENSMUSP00000005220
Gene: ENSMUSG00000005089

Domain	Start	End	E-Value	Type
Pfam:SDF	43	492	8.9e-137	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000080210

SMART Domains

Protein: ENSMUSP00000079100
Gene: ENSMUSG00000005089

Domain	Start	End	E-Value	Type
Pfam:SDF	46	495	3e-133	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111212

SMART Domains

Protein: ENSMUSP00000106843
Gene: ENSMUSG00000005089

Domain	Start	End	E-Value	Type
Pfam:SDF	43	492	9.5e-137	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111213

SMART Domains

Protein: ENSMUSP00000106844
Gene: ENSMUSG00000005089

Domain	Start	End	E-Value	Type
Pfam:SDF	46	495	2e-134	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123759

SMART Domains

Protein: ENSMUSP00000115129
Gene: ENSMUSG00000005089

Domain	Start	End	E-Value	Type
Pfam:SDF	37	157	4.5e-30	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of solute transporter proteins. The membrane-bound protein is the principal transporter that clears the excitatory neurotransmitter glutamate from the extracellular space at synapses in the central nervous system. Glutamate clearance is necessary for proper synaptic activation and to prevent neuronal damage from excessive activation of glutamate receptors. Mutations in and decreased expression of this protein are associated with amyotrophic lateral sclerosis. Alternatively spliced transcript variants of this gene have been identified. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display spontaneous seizures often leading to death as well as a succeptibility to neuronal degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,743,598	L136P	probably benign	Het
4932438H23Rik	T	G	16: 91,055,612	Y212S	probably damaging	Het
Angpt1	T	C	15: 42,512,399	N154D	probably damaging	Het
Angpt2	G	A	8: 18,741,119	R54*	probably null	Het
Ankrd27	T	A	7: 35,601,626	L117*	probably null	Het
Arhgap21	C	T	2: 20,854,180	M1234I	probably benign	Het
Arhgef33	A	G	17: 80,367,335	E387G	probably damaging	Het
Atp13a4	T	A	16: 29,454,769	K444*	probably null	Het
Atp6v1a	G	A	16: 44,101,862	R338C	probably damaging	Het
Canx	T	C	11: 50,311,647	D44G	possibly damaging	Het
Ccdc141	T	A	2: 77,132,244	M119L	probably benign	Het
Ckmt1	A	C	2: 121,362,691	Q299P	possibly damaging	Het
Dhx16	T	C	17: 35,885,920	S601P	probably damaging	Het
Dna2	A	C	10: 62,950,894	R140S	probably damaging	Het
Dock1	A	G	7: 134,782,409	T670A	probably benign	Het
Eogt	A	G	6: 97,143,998	S85P	possibly damaging	Het
Fbf1	A	T	11: 116,165,881	M1K	probably null	Het
Fbxl12	C	A	9: 20,638,864	R165L	possibly damaging	Het
Flnb	G	A	14: 7,950,394	V2571I	probably damaging	Het
Gm11361	A	G	13: 28,257,711	I26V	probably benign	Het
Gm43518	A	G	5: 123,938,259	E123G	unknown	Het
Gm8332	T	G	12: 88,249,685	E139A	unknown	Het
Gpatch2	A	G	1: 187,304,355	N374S	probably benign	Het
Hey1	G	C	3: 8,664,776	A207G	probably benign	Het
Hoxa11	T	C	6: 52,245,802		probably benign	Het
Hydin	G	A	8: 110,582,018	V3979I	probably benign	Het
Ighe	C	T	12: 113,271,793	W277*	probably null	Het
Kmt2c	G	T	5: 25,314,122	T2330K	probably benign	Het
Krt6a	T	A	15: 101,692,735	K261M	probably damaging	Het
Lats2	A	C	14: 57,722,705	S161A	probably benign	Het
Med13l	T	A	5: 118,754,321	D1936E	probably benign	Het
Mipol1	T	C	12: 57,306,088	V71A	possibly damaging	Het
Mphosph8	A	T	14: 56,676,546	K415*	probably null	Het
Npepps	A	G	11: 97,244,426		probably null	Het
Ntn4	A	T	10: 93,741,104	N545Y	possibly damaging	Het
Olfr1501	A	T	19: 13,838,402	M257K	possibly damaging	Het
Olfr164	T	C	16: 19,286,701	D14G	probably benign	Het
Olfr353	A	G	2: 36,890,354	S165P	probably damaging	Het
Olfr738	A	C	14: 50,413,675	M44L	probably benign	Het
Osbpl2	T	A	2: 180,155,343	V358E	possibly damaging	Het
Pdcd11	C	A	19: 47,119,806	P1204Q	probably damaging	Het
Pnliprp2	A	C	19: 58,763,374	S184R	probably damaging	Het
Ppm1g	G	T	5: 31,204,528	R373S	probably damaging	Het
Rnf130	A	G	11: 50,087,437	D275G	probably damaging	Het
Setd5	T	C	6: 113,121,087	S696P	probably damaging	Het
Sgip1	A	G	4: 102,915,071	Q219R	probably benign	Het
Slc22a12	T	C	19: 6,542,437	T106A	probably benign	Het
Slc22a14	A	G	9: 119,180,585	L148P	probably damaging	Het
Slc2a9	A	T	5: 38,382,078	F375I	probably damaging	Het
Sorbs3	A	T	14: 70,202,947	D117E	probably benign	Het
Sphkap	G	A	1: 83,276,500	T1176I	probably damaging	Het
Supt16	A	T	14: 52,181,589	V193D	probably damaging	Het
Sytl3	A	G	17: 6,728,291	T362A	probably damaging	Het
Tctn1	T	A	5: 122,246,611	Q410L	probably benign	Het
Trbc2	T	C	6: 41,547,777	Y133H		Het
Ttc28	G	A	5: 111,233,341	D1240N	probably benign	Het
Vmn2r120	A	G	17: 57,525,843	V112A	probably benign	Het
Zfp354b	A	T	11: 50,923,470	S209R	probably benign	Het
Zfp362	T	C	4: 128,774,606	H391R	probably damaging	Het

Other mutations in Slc1a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Slc1a2	APN	2	102777576	missense	possibly damaging	0.55
IGL00588:Slc1a2	APN	2	102756001	missense	probably benign
IGL00931:Slc1a2	APN	2	102756112	missense	probably damaging	1.00
IGL00942:Slc1a2	APN	2	102739814	missense	probably damaging	1.00
IGL02100:Slc1a2	APN	2	102756089	missense	probably damaging	1.00
IGL02173:Slc1a2	APN	2	102743861	missense	probably benign	0.05
IGL02184:Slc1a2	APN	2	102748544	missense	probably damaging	1.00
IGL02480:Slc1a2	APN	2	102736066	missense	probably damaging	1.00
IGL02643:Slc1a2	APN	2	102739880	missense	probably benign	0.30
IGL03332:Slc1a2	APN	2	102748534	missense	possibly damaging	0.96
R0335:Slc1a2	UTSW	2	102743863	missense	probably benign
R0544:Slc1a2	UTSW	2	102756072	missense	probably damaging	0.99
R0570:Slc1a2	UTSW	2	102756007	missense	probably damaging	1.00
R1472:Slc1a2	UTSW	2	102737909	missense	probably damaging	1.00
R1536:Slc1a2	UTSW	2	102777510	missense	probably benign	0.37
R1856:Slc1a2	UTSW	2	102777567	missense	probably damaging	0.97
R1936:Slc1a2	UTSW	2	102777605	missense	probably benign	0.04
R1965:Slc1a2	UTSW	2	102739900	missense	probably damaging	1.00
R2270:Slc1a2	UTSW	2	102735994	missense	probably damaging	1.00
R2365:Slc1a2	UTSW	2	102748453	splice site	probably null
R2567:Slc1a2	UTSW	2	102767010	missense	probably damaging	1.00
R2878:Slc1a2	UTSW	2	102761167	missense	probably damaging	1.00
R3080:Slc1a2	UTSW	2	102748556	missense	probably damaging	1.00
R4716:Slc1a2	UTSW	2	102748538	missense	probably damaging	0.96
R4744:Slc1a2	UTSW	2	102737869	missense	probably benign	0.41
R5197:Slc1a2	UTSW	2	102756115	missense	probably benign	0.02
R5835:Slc1a2	UTSW	2	102777450	missense	probably damaging	1.00
R7077:Slc1a2	UTSW	2	102777510	missense	probably benign	0.37
R7155:Slc1a2	UTSW	2	102766995	missense	probably damaging	1.00
R7179:Slc1a2	UTSW	2	102755945	missense	probably damaging	1.00
R7455:Slc1a2	UTSW	2	102735954	missense	probably benign	0.16
R7492:Slc1a2	UTSW	2	102739930	nonsense	probably null
R7818:Slc1a2	UTSW	2	102743956	missense	probably benign	0.06
R7868:Slc1a2	UTSW	2	102761185	missense	probably benign	0.06
R8143:Slc1a2	UTSW	2	102737885	missense	probably damaging	1.00
R8184:Slc1a2	UTSW	2	102737852	missense	probably damaging	1.00
R8436:Slc1a2	UTSW	2	102755953	missense	possibly damaging	0.65
R8830:Slc1a2	UTSW	2	102736015	missense	probably benign
R8951:Slc1a2	UTSW	2	102756008	missense	probably damaging	1.00
R9424:Slc1a2	UTSW	2	102761049	missense	probably damaging	1.00
X0065:Slc1a2	UTSW	2	102737831	missense	probably benign	0.12
Z1177:Slc1a2	UTSW	2	102761125	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGGAGACCCCGATTATCTCAG -3'
(R):5'- AGGGAACTCACAGACTGCAG -3'

Sequencing Primer
(F):5'- CGATTATCTCAGCTCAGGGAGTC -3'
(R):5'- ACTCACAGACTGCAGAGGAG -3'

Posted On

2020-10-20