Incidental Mutation 'R8508:Ckmt1'
ID655682
Institutional Source Beutler Lab
Gene Symbol Ckmt1
Ensembl Gene ENSMUSG00000000308
Gene Namecreatine kinase, mitochondrial 1, ubiquitous
Synonymsmi-CK, UbCKmit, Mt-CK
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock #R8508 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location121357714-121363737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 121362691 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 299 (Q299P)
Ref Sequence ENSEMBL: ENSMUSP00000000317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000317] [ENSMUST00000038389] [ENSMUST00000078222] [ENSMUST00000125221] [ENSMUST00000125812] [ENSMUST00000126130] [ENSMUST00000128612] [ENSMUST00000129130] [ENSMUST00000150271]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000317
AA Change: Q299P

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000000317
Gene: ENSMUSG00000000308
AA Change: Q299P

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 58 133 5.8e-34 PFAM
Pfam:ATP-gua_Ptrans 154 401 4.5e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038389
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000078222
AA Change: Q299P

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077349
Gene: ENSMUSG00000000308
AA Change: Q299P

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 134 1.2e-37 PFAM
Pfam:ATP-gua_Ptrans 154 401 2e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125221
SMART Domains Protein: ENSMUSP00000121930
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 117 5.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125812
SMART Domains Protein: ENSMUSP00000115501
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 134 9.7e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126130
SMART Domains Protein: ENSMUSP00000117463
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
low complexity region 39 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128612
SMART Domains Protein: ENSMUSP00000115610
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
low complexity region 47 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129130
SMART Domains Protein: ENSMUSP00000123130
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 86 165 5.7e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150271
SMART Domains Protein: ENSMUSP00000120507
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 134 3.3e-38 PFAM
Pfam:ATP-gua_Ptrans 154 251 3.8e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele have no visual or motor impairments but display diminished open field habituation and slower spatial learning acquisition in the Morris water maze task as well as a reduced acoustic startle response, higher threshold, and lack of prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,598 L136P probably benign Het
4932438H23Rik T G 16: 91,055,612 Y212S probably damaging Het
Angpt1 T C 15: 42,512,399 N154D probably damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Ankrd27 T A 7: 35,601,626 L117* probably null Het
Arhgap21 C T 2: 20,854,180 M1234I probably benign Het
Arhgef33 A G 17: 80,367,335 E387G probably damaging Het
Atp13a4 T A 16: 29,454,769 K444* probably null Het
Atp6v1a G A 16: 44,101,862 R338C probably damaging Het
Canx T C 11: 50,311,647 D44G possibly damaging Het
Ccdc141 T A 2: 77,132,244 M119L probably benign Het
Dhx16 T C 17: 35,885,920 S601P probably damaging Het
Dna2 A C 10: 62,950,894 R140S probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Eogt A G 6: 97,143,998 S85P possibly damaging Het
Fbf1 A T 11: 116,165,881 M1K probably null Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flnb G A 14: 7,950,394 V2571I probably damaging Het
Gm11361 A G 13: 28,257,711 I26V probably benign Het
Gm43518 A G 5: 123,938,259 E123G unknown Het
Gm8332 T G 12: 88,249,685 E139A unknown Het
Gpatch2 A G 1: 187,304,355 N374S probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Hoxa11 T C 6: 52,245,802 probably benign Het
Hydin G A 8: 110,582,018 V3979I probably benign Het
Ighe C T 12: 113,271,793 W277* probably null Het
Kmt2c G T 5: 25,314,122 T2330K probably benign Het
Krt6a T A 15: 101,692,735 K261M probably damaging Het
Lats2 A C 14: 57,722,705 S161A probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Npepps A G 11: 97,244,426 probably null Het
Ntn4 A T 10: 93,741,104 N545Y possibly damaging Het
Olfr1501 A T 19: 13,838,402 M257K possibly damaging Het
Olfr164 T C 16: 19,286,701 D14G probably benign Het
Olfr353 A G 2: 36,890,354 S165P probably damaging Het
Olfr738 A C 14: 50,413,675 M44L probably benign Het
Osbpl2 T A 2: 180,155,343 V358E possibly damaging Het
Pdcd11 C A 19: 47,119,806 P1204Q probably damaging Het
Pnliprp2 A C 19: 58,763,374 S184R probably damaging Het
Ppm1g G T 5: 31,204,528 R373S probably damaging Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Setd5 T C 6: 113,121,087 S696P probably damaging Het
Sgip1 A G 4: 102,915,071 Q219R probably benign Het
Slc1a2 T C 2: 102,736,085 probably null Het
Slc22a12 T C 19: 6,542,437 T106A probably benign Het
Slc22a14 A G 9: 119,180,585 L148P probably damaging Het
Slc2a9 A T 5: 38,382,078 F375I probably damaging Het
Sorbs3 A T 14: 70,202,947 D117E probably benign Het
Sphkap G A 1: 83,276,500 T1176I probably damaging Het
Supt16 A T 14: 52,181,589 V193D probably damaging Het
Sytl3 A G 17: 6,728,291 T362A probably damaging Het
Tctn1 T A 5: 122,246,611 Q410L probably benign Het
Trbc2 T C 6: 41,547,777 Y133H Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r120 A G 17: 57,525,843 V112A probably benign Het
Zfp354b A T 11: 50,923,470 S209R probably benign Het
Zfp362 T C 4: 128,774,606 H391R probably damaging Het
Other mutations in Ckmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Ckmt1 APN 2 121361150 missense probably damaging 1.00
IGL01141:Ckmt1 APN 2 121362993 missense probably benign 0.07
IGL01403:Ckmt1 APN 2 121362966 unclassified probably benign
IGL01971:Ckmt1 APN 2 121363583 missense probably benign 0.41
IGL02037:Ckmt1 APN 2 121361162 missense probably damaging 0.99
IGL02750:Ckmt1 APN 2 121363615 unclassified probably benign
IGL03303:Ckmt1 APN 2 121360005 missense probably benign
R0157:Ckmt1 UTSW 2 121363041 missense possibly damaging 0.86
R0331:Ckmt1 UTSW 2 121362856 splice site probably null
R1590:Ckmt1 UTSW 2 121363522 missense possibly damaging 0.96
R1640:Ckmt1 UTSW 2 121359717 splice site probably null
R1853:Ckmt1 UTSW 2 121360650 missense probably damaging 1.00
R4726:Ckmt1 UTSW 2 121361231 critical splice donor site probably null
R4788:Ckmt1 UTSW 2 121359946 missense possibly damaging 0.87
R5632:Ckmt1 UTSW 2 121360592 missense probably damaging 1.00
R5633:Ckmt1 UTSW 2 121363629 unclassified probably benign
R5960:Ckmt1 UTSW 2 121363577 missense probably damaging 1.00
R6123:Ckmt1 UTSW 2 121363579 missense probably benign 0.05
R6673:Ckmt1 UTSW 2 121359670 missense probably damaging 1.00
R7220:Ckmt1 UTSW 2 121358893 missense possibly damaging 0.96
R8100:Ckmt1 UTSW 2 121360777 missense probably benign
R8359:Ckmt1 UTSW 2 121363050 missense probably benign 0.00
R8512:Ckmt1 UTSW 2 121361208 missense probably damaging 1.00
X0067:Ckmt1 UTSW 2 121360967 nonsense probably null
Z1177:Ckmt1 UTSW 2 121359575 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACATCCAAGTGTCCTTCCATGTG -3'
(R):5'- TAAGCCCATAGGACTGGCTC -3'

Sequencing Primer
(F):5'- AAGTGTCCTTCCATGTGCAATGAC -3'
(R):5'- AAGCCCATAGGACTGGCTCTTTTTAG -3'
Posted On2020-10-20