Incidental Mutation 'R8508:Hey1'
ID655684
Institutional Source Beutler Lab
Gene Symbol Hey1
Ensembl Gene ENSMUSG00000040289
Gene Namehairy/enhancer-of-split related with YRPW motif 1
SynonymsHRT1, CHF2, hesr-1, bHLHb31, Herp2, Hesr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8508 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location8663359-8667256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 8664776 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 207 (A207G)
Ref Sequence ENSEMBL: ENSMUSP00000038014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042412]
Predicted Effect probably benign
Transcript: ENSMUST00000042412
AA Change: A207G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038014
Gene: ENSMUSG00000040289
AA Change: A207G

DomainStartEndE-ValueType
HLH 55 110 2.3e-14 SMART
ORANGE 120 167 2.8e-14 SMART
low complexity region 186 197 N/A INTRINSIC
low complexity region 232 244 N/A INTRINSIC
low complexity region 246 277 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein belonging to the hairy and enhancer of split-related (HESR) family of basic helix-loop-helix (bHLH)-type transcriptional repressors. Expression of this gene is induced by the Notch and c-Jun signal transduction pathways. Two similar and redundant genes in mouse are required for embryonic cardiovascular development, and are also implicated in neurogenesis and somitogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile with no major developmental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,598 L136P probably benign Het
4932438H23Rik T G 16: 91,055,612 Y212S probably damaging Het
Angpt1 T C 15: 42,512,399 N154D probably damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Ankrd27 T A 7: 35,601,626 L117* probably null Het
Arhgap21 C T 2: 20,854,180 M1234I probably benign Het
Arhgef33 A G 17: 80,367,335 E387G probably damaging Het
Atp13a4 T A 16: 29,454,769 K444* probably null Het
Atp6v1a G A 16: 44,101,862 R338C probably damaging Het
Canx T C 11: 50,311,647 D44G possibly damaging Het
Ccdc141 T A 2: 77,132,244 M119L probably benign Het
Ckmt1 A C 2: 121,362,691 Q299P possibly damaging Het
Dhx16 T C 17: 35,885,920 S601P probably damaging Het
Dna2 A C 10: 62,950,894 R140S probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Eogt A G 6: 97,143,998 S85P possibly damaging Het
Fbf1 A T 11: 116,165,881 M1K probably null Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flnb G A 14: 7,950,394 V2571I probably damaging Het
Gm11361 A G 13: 28,257,711 I26V probably benign Het
Gm43518 A G 5: 123,938,259 E123G unknown Het
Gm8332 T G 12: 88,249,685 E139A unknown Het
Gpatch2 A G 1: 187,304,355 N374S probably benign Het
Hoxa11 T C 6: 52,245,802 probably benign Het
Hydin G A 8: 110,582,018 V3979I probably benign Het
Ighe C T 12: 113,271,793 W277* probably null Het
Kmt2c G T 5: 25,314,122 T2330K probably benign Het
Krt6a T A 15: 101,692,735 K261M probably damaging Het
Lats2 A C 14: 57,722,705 S161A probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Npepps A G 11: 97,244,426 probably null Het
Ntn4 A T 10: 93,741,104 N545Y possibly damaging Het
Olfr1501 A T 19: 13,838,402 M257K possibly damaging Het
Olfr164 T C 16: 19,286,701 D14G probably benign Het
Olfr353 A G 2: 36,890,354 S165P probably damaging Het
Olfr738 A C 14: 50,413,675 M44L probably benign Het
Osbpl2 T A 2: 180,155,343 V358E possibly damaging Het
Pdcd11 C A 19: 47,119,806 P1204Q probably damaging Het
Pnliprp2 A C 19: 58,763,374 S184R probably damaging Het
Ppm1g G T 5: 31,204,528 R373S probably damaging Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Setd5 T C 6: 113,121,087 S696P probably damaging Het
Sgip1 A G 4: 102,915,071 Q219R probably benign Het
Slc1a2 T C 2: 102,736,085 probably null Het
Slc22a12 T C 19: 6,542,437 T106A probably benign Het
Slc22a14 A G 9: 119,180,585 L148P probably damaging Het
Slc2a9 A T 5: 38,382,078 F375I probably damaging Het
Sorbs3 A T 14: 70,202,947 D117E probably benign Het
Sphkap G A 1: 83,276,500 T1176I probably damaging Het
Supt16 A T 14: 52,181,589 V193D probably damaging Het
Sytl3 A G 17: 6,728,291 T362A probably damaging Het
Tctn1 T A 5: 122,246,611 Q410L probably benign Het
Trbc2 T C 6: 41,547,777 Y133H Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r120 A G 17: 57,525,843 V112A probably benign Het
Zfp354b A T 11: 50,923,470 S209R probably benign Het
Zfp362 T C 4: 128,774,606 H391R probably damaging Het
Other mutations in Hey1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Hey1 APN 3 8666580 splice site probably null
IGL02486:Hey1 APN 3 8666519 missense probably damaging 1.00
IGL03265:Hey1 APN 3 8664914 missense probably benign 0.07
R1615:Hey1 UTSW 3 8664838 missense possibly damaging 0.47
R1969:Hey1 UTSW 3 8666819 missense probably benign 0.01
R1987:Hey1 UTSW 3 8664897 missense probably benign 0.16
R2419:Hey1 UTSW 3 8665943 critical splice donor site probably null
R3177:Hey1 UTSW 3 8664891 missense probably benign 0.10
R3277:Hey1 UTSW 3 8664891 missense probably benign 0.10
R3941:Hey1 UTSW 3 8664578 missense probably damaging 1.00
R4709:Hey1 UTSW 3 8665903 intron probably benign
R5977:Hey1 UTSW 3 8666358 splice site probably null
R5988:Hey1 UTSW 3 8666319 missense probably damaging 1.00
R7951:Hey1 UTSW 3 8664872 missense possibly damaging 0.92
R8507:Hey1 UTSW 3 8664776 missense probably benign
R8509:Hey1 UTSW 3 8664776 missense probably benign
X0019:Hey1 UTSW 3 8664867 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATAGGGCTTGCCAAGGTTTG -3'
(R):5'- TTGAAGGACTCGATGCCTCC -3'

Sequencing Primer
(F):5'- TGCCAAGGTTTGCTGCC -3'
(R):5'- ACTCGATGCCTCCGACCC -3'
Posted On2020-10-20