Incidental Mutation 'R8508:Zfp362'
ID 655686
Institutional Source Beutler Lab
Gene Symbol Zfp362
Ensembl Gene ENSMUSG00000028799
Gene Name zinc finger protein 362
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock # R8508 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 128773088-128806045 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128774606 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 391 (H391R)
Ref Sequence ENSEMBL: ENSMUSP00000065733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071108] [ENSMUST00000106072] [ENSMUST00000170934]
AlphaFold B1ASA5
Predicted Effect probably damaging
Transcript: ENSMUST00000071108
AA Change: H391R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065733
Gene: ENSMUSG00000028799
AA Change: H391R

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
low complexity region 128 150 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
ZnF_C2H2 225 247 2.75e-3 SMART
ZnF_C2H2 253 275 1.98e-4 SMART
ZnF_C2H2 281 303 1.38e-3 SMART
ZnF_C2H2 309 333 3.49e-5 SMART
ZnF_C2H2 339 361 1.08e-1 SMART
ZnF_C2H2 369 391 7.26e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106072
AA Change: H391R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101686
Gene: ENSMUSG00000028799
AA Change: H391R

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
low complexity region 128 150 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
ZnF_C2H2 225 247 2.75e-3 SMART
ZnF_C2H2 253 275 1.98e-4 SMART
ZnF_C2H2 281 303 1.38e-3 SMART
ZnF_C2H2 309 333 3.49e-5 SMART
ZnF_C2H2 339 361 1.08e-1 SMART
ZnF_C2H2 369 391 7.26e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170934
SMART Domains Protein: ENSMUSP00000128499
Gene: ENSMUSG00000028799

DomainStartEndE-ValueType
low complexity region 115 137 N/A INTRINSIC
low complexity region 187 198 N/A INTRINSIC
ZnF_C2H2 212 234 2.75e-3 SMART
ZnF_C2H2 240 262 1.98e-4 SMART
ZnF_C2H2 268 290 1.38e-3 SMART
ZnF_C2H2 296 320 3.49e-5 SMART
ZnF_C2H2 326 348 1.08e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,598 L136P probably benign Het
4932438H23Rik T G 16: 91,055,612 Y212S probably damaging Het
Angpt1 T C 15: 42,512,399 N154D probably damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Ankrd27 T A 7: 35,601,626 L117* probably null Het
Arhgap21 C T 2: 20,854,180 M1234I probably benign Het
Arhgef33 A G 17: 80,367,335 E387G probably damaging Het
Atp13a4 T A 16: 29,454,769 K444* probably null Het
Atp6v1a G A 16: 44,101,862 R338C probably damaging Het
Canx T C 11: 50,311,647 D44G possibly damaging Het
Ccdc141 T A 2: 77,132,244 M119L probably benign Het
Ckmt1 A C 2: 121,362,691 Q299P possibly damaging Het
Dhx16 T C 17: 35,885,920 S601P probably damaging Het
Dna2 A C 10: 62,950,894 R140S probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Eogt A G 6: 97,143,998 S85P possibly damaging Het
Fbf1 A T 11: 116,165,881 M1K probably null Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flnb G A 14: 7,950,394 V2571I probably damaging Het
Gm11361 A G 13: 28,257,711 I26V probably benign Het
Gm43518 A G 5: 123,938,259 E123G unknown Het
Gm8332 T G 12: 88,249,685 E139A unknown Het
Gpatch2 A G 1: 187,304,355 N374S probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Hoxa11 T C 6: 52,245,802 probably benign Het
Hydin G A 8: 110,582,018 V3979I probably benign Het
Ighe C T 12: 113,271,793 W277* probably null Het
Kmt2c G T 5: 25,314,122 T2330K probably benign Het
Krt6a T A 15: 101,692,735 K261M probably damaging Het
Lats2 A C 14: 57,722,705 S161A probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Npepps A G 11: 97,244,426 probably null Het
Ntn4 A T 10: 93,741,104 N545Y possibly damaging Het
Olfr1501 A T 19: 13,838,402 M257K possibly damaging Het
Olfr164 T C 16: 19,286,701 D14G probably benign Het
Olfr353 A G 2: 36,890,354 S165P probably damaging Het
Olfr738 A C 14: 50,413,675 M44L probably benign Het
Osbpl2 T A 2: 180,155,343 V358E possibly damaging Het
Pdcd11 C A 19: 47,119,806 P1204Q probably damaging Het
Pnliprp2 A C 19: 58,763,374 S184R probably damaging Het
Ppm1g G T 5: 31,204,528 R373S probably damaging Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Setd5 T C 6: 113,121,087 S696P probably damaging Het
Sgip1 A G 4: 102,915,071 Q219R probably benign Het
Slc1a2 T C 2: 102,736,085 probably null Het
Slc22a12 T C 19: 6,542,437 T106A probably benign Het
Slc22a14 A G 9: 119,180,585 L148P probably damaging Het
Slc2a9 A T 5: 38,382,078 F375I probably damaging Het
Sorbs3 A T 14: 70,202,947 D117E probably benign Het
Sphkap G A 1: 83,276,500 T1176I probably damaging Het
Supt16 A T 14: 52,181,589 V193D probably damaging Het
Sytl3 A G 17: 6,728,291 T362A probably damaging Het
Tctn1 T A 5: 122,246,611 Q410L probably benign Het
Trbc2 T C 6: 41,547,777 Y133H Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r120 A G 17: 57,525,843 V112A probably benign Het
Zfp354b A T 11: 50,923,470 S209R probably benign Het
Other mutations in Zfp362
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Zfp362 APN 4 128787109 missense probably damaging 1.00
IGL01939:Zfp362 APN 4 128787053 missense probably benign
trek UTSW 4 128785976 missense probably damaging 1.00
Zax UTSW 4 128790260 missense possibly damaging 0.71
Zebulon UTSW 4 128786015 missense probably damaging 1.00
R1471:Zfp362 UTSW 4 128787200 missense probably benign
R1892:Zfp362 UTSW 4 128790264 missense probably benign 0.17
R1901:Zfp362 UTSW 4 128790276 missense probably damaging 1.00
R2058:Zfp362 UTSW 4 128786987 missense possibly damaging 0.71
R3739:Zfp362 UTSW 4 128786889 splice site probably benign
R6772:Zfp362 UTSW 4 128790260 missense possibly damaging 0.71
R6900:Zfp362 UTSW 4 128786015 missense probably damaging 1.00
R6901:Zfp362 UTSW 4 128786015 missense probably damaging 1.00
R7105:Zfp362 UTSW 4 128774526 missense probably damaging 0.99
R7348:Zfp362 UTSW 4 128777217 missense possibly damaging 0.88
R7629:Zfp362 UTSW 4 128786055 missense probably damaging 1.00
R7712:Zfp362 UTSW 4 128777410 missense probably benign 0.14
R7763:Zfp362 UTSW 4 128787031 missense probably benign
R8434:Zfp362 UTSW 4 128785976 missense probably damaging 1.00
R9432:Zfp362 UTSW 4 128777187 missense probably damaging 1.00
Z1177:Zfp362 UTSW 4 128774550 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTGGACCAAGCTTTCTGG -3'
(R):5'- GGACTGAACTCCAGCAAAGC -3'

Sequencing Primer
(F):5'- ACCAAGCTTTCTGGCAGGTTTG -3'
(R):5'- GACTGAACTCCAGCAAAGCAAAGATC -3'
Posted On 2020-10-20