Incidental Mutation 'R8508:Ppm1g'
ID655688
Institutional Source Beutler Lab
Gene Symbol Ppm1g
Ensembl Gene ENSMUSG00000029147
Gene Nameprotein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform
SynonymsFin13
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8508 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location31202664-31220687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 31204528 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 373 (R373S)
Ref Sequence ENSEMBL: ENSMUSP00000031032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031032] [ENSMUST00000031562] [ENSMUST00000114590] [ENSMUST00000201231] [ENSMUST00000201407] [ENSMUST00000201968] [ENSMUST00000202294] [ENSMUST00000202929]
Predicted Effect probably damaging
Transcript: ENSMUST00000031032
AA Change: R373S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031032
Gene: ENSMUSG00000029147
AA Change: R373S

DomainStartEndE-ValueType
PP2Cc 15 500 9.7e-103 SMART
PP2C_SIG 219 502 1.05e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031562
SMART Domains Protein: ENSMUSP00000031562
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 35 55 N/A INTRINSIC
low complexity region 100 117 N/A INTRINSIC
low complexity region 121 144 N/A INTRINSIC
ZnF_C2H2 148 170 1.33e-1 SMART
ZnF_C2H2 176 198 2.86e-1 SMART
ZnF_C2H2 204 226 1.06e-4 SMART
low complexity region 227 238 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
ZnF_C2H2 358 380 1.03e-2 SMART
ZnF_C2H2 386 408 5.42e-2 SMART
ZnF_C2H2 414 436 2.91e-2 SMART
ZnF_C2H2 442 464 1.38e-3 SMART
ZnF_C2H2 470 492 5.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114590
SMART Domains Protein: ENSMUSP00000110238
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 37 57 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
low complexity region 123 146 N/A INTRINSIC
ZnF_C2H2 150 172 1.33e-1 SMART
ZnF_C2H2 178 200 2.86e-1 SMART
ZnF_C2H2 206 228 1.06e-4 SMART
low complexity region 229 240 N/A INTRINSIC
low complexity region 342 356 N/A INTRINSIC
ZnF_C2H2 360 382 1.03e-2 SMART
ZnF_C2H2 388 410 5.42e-2 SMART
ZnF_C2H2 416 438 2.91e-2 SMART
ZnF_C2H2 444 466 1.38e-3 SMART
ZnF_C2H2 472 494 5.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200778
Predicted Effect probably benign
Transcript: ENSMUST00000201231
SMART Domains Protein: ENSMUSP00000144172
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 35 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201407
SMART Domains Protein: ENSMUSP00000144556
Gene: ENSMUSG00000029147

DomainStartEndE-ValueType
Blast:PP2Cc 1 155 4e-87 BLAST
low complexity region 156 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201968
SMART Domains Protein: ENSMUSP00000144517
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 80 92 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202294
AA Change: R266S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144644
Gene: ENSMUSG00000029147
AA Change: R266S

DomainStartEndE-ValueType
PP2Cc 15 393 6.6e-105 SMART
PP2C_SIG 38 395 3.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202929
SMART Domains Protein: ENSMUSP00000143817
Gene: ENSMUSG00000043059

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase is found to be responsible for the dephosphorylation of Pre-mRNA splicing factors, which is important for the formation of functional spliceosome. Studies of a similar gene in mice suggested a role of this phosphatase in regulating cell cycle progression. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a targeted mutation display perinatal lethality. Mice heterozygous for a targeted mutation display a decrease in prepulse inhibition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,598 L136P probably benign Het
4932438H23Rik T G 16: 91,055,612 Y212S probably damaging Het
Angpt1 T C 15: 42,512,399 N154D probably damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Ankrd27 T A 7: 35,601,626 L117* probably null Het
Arhgap21 C T 2: 20,854,180 M1234I probably benign Het
Arhgef33 A G 17: 80,367,335 E387G probably damaging Het
Atp13a4 T A 16: 29,454,769 K444* probably null Het
Atp6v1a G A 16: 44,101,862 R338C probably damaging Het
Canx T C 11: 50,311,647 D44G possibly damaging Het
Ccdc141 T A 2: 77,132,244 M119L probably benign Het
Ckmt1 A C 2: 121,362,691 Q299P possibly damaging Het
Dhx16 T C 17: 35,885,920 S601P probably damaging Het
Dna2 A C 10: 62,950,894 R140S probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Eogt A G 6: 97,143,998 S85P possibly damaging Het
Fbf1 A T 11: 116,165,881 M1K probably null Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flnb G A 14: 7,950,394 V2571I probably damaging Het
Gm11361 A G 13: 28,257,711 I26V probably benign Het
Gm43518 A G 5: 123,938,259 E123G unknown Het
Gm8332 T G 12: 88,249,685 E139A unknown Het
Gpatch2 A G 1: 187,304,355 N374S probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Hoxa11 T C 6: 52,245,802 probably benign Het
Hydin G A 8: 110,582,018 V3979I probably benign Het
Ighe C T 12: 113,271,793 W277* probably null Het
Kmt2c G T 5: 25,314,122 T2330K probably benign Het
Krt6a T A 15: 101,692,735 K261M probably damaging Het
Lats2 A C 14: 57,722,705 S161A probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Npepps A G 11: 97,244,426 probably null Het
Ntn4 A T 10: 93,741,104 N545Y possibly damaging Het
Olfr1501 A T 19: 13,838,402 M257K possibly damaging Het
Olfr164 T C 16: 19,286,701 D14G probably benign Het
Olfr353 A G 2: 36,890,354 S165P probably damaging Het
Olfr738 A C 14: 50,413,675 M44L probably benign Het
Osbpl2 T A 2: 180,155,343 V358E possibly damaging Het
Pdcd11 C A 19: 47,119,806 P1204Q probably damaging Het
Pnliprp2 A C 19: 58,763,374 S184R probably damaging Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Setd5 T C 6: 113,121,087 S696P probably damaging Het
Sgip1 A G 4: 102,915,071 Q219R probably benign Het
Slc1a2 T C 2: 102,736,085 probably null Het
Slc22a12 T C 19: 6,542,437 T106A probably benign Het
Slc22a14 A G 9: 119,180,585 L148P probably damaging Het
Slc2a9 A T 5: 38,382,078 F375I probably damaging Het
Sorbs3 A T 14: 70,202,947 D117E probably benign Het
Sphkap G A 1: 83,276,500 T1176I probably damaging Het
Supt16 A T 14: 52,181,589 V193D probably damaging Het
Sytl3 A G 17: 6,728,291 T362A probably damaging Het
Tctn1 T A 5: 122,246,611 Q410L probably benign Het
Trbc2 T C 6: 41,547,777 Y133H Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r120 A G 17: 57,525,843 V112A probably benign Het
Zfp354b A T 11: 50,923,470 S209R probably benign Het
Zfp362 T C 4: 128,774,606 H391R probably damaging Het
Other mutations in Ppm1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02517:Ppm1g APN 5 31208081 missense probably damaging 1.00
R0843:Ppm1g UTSW 5 31207551 splice site probably benign
R1483:Ppm1g UTSW 5 31203121 missense probably benign 0.45
R1750:Ppm1g UTSW 5 31206216 missense probably damaging 1.00
R5611:Ppm1g UTSW 5 31206097 missense probably damaging 1.00
R5776:Ppm1g UTSW 5 31205110 missense probably benign 0.01
R6274:Ppm1g UTSW 5 31206406 missense probably damaging 0.99
R6450:Ppm1g UTSW 5 31203124 missense probably benign 0.01
R7360:Ppm1g UTSW 5 31203277 missense probably damaging 1.00
R7642:Ppm1g UTSW 5 31205103 nonsense probably null
Z1176:Ppm1g UTSW 5 31220436 start gained probably benign
Z1177:Ppm1g UTSW 5 31220314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTTAACATCCAGAACACAGGG -3'
(R):5'- CACAAGGCTCTGCTTGTTCC -3'

Sequencing Primer
(F):5'- CAAAGAAGGCATGAGCTTATTCTG -3'
(R):5'- CTTTTAAGCCTGGTTCTGACAG -3'
Posted On2020-10-20