Incidental Mutation 'R8508:Slc2a9'
ID655689
Institutional Source Beutler Lab
Gene Symbol Slc2a9
Ensembl Gene ENSMUSG00000005107
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 9
SynonymsSLC2a9A, Glut9, SLC2A9B
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R8508 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location38349273-38503143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38382078 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 375 (F375I)
Ref Sequence ENSEMBL: ENSMUSP00000063352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005238] [ENSMUST00000067872] [ENSMUST00000067886] [ENSMUST00000122970] [ENSMUST00000129099] [ENSMUST00000143758] [ENSMUST00000155634] [ENSMUST00000156272]
Predicted Effect probably damaging
Transcript: ENSMUST00000005238
AA Change: F253I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005238
Gene: ENSMUSG00000005107
AA Change: F253I

DomainStartEndE-ValueType
Pfam:MFS_1 20 208 3.5e-10 PFAM
Pfam:Sugar_tr 25 188 1.1e-35 PFAM
Pfam:Sugar_tr 191 373 5.3e-39 PFAM
Pfam:MFS_1 196 397 1.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000067872
AA Change: F360I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066872
Gene: ENSMUSG00000005107
AA Change: F360I

DomainStartEndE-ValueType
Pfam:MFS_1 22 329 2.2e-16 PFAM
Pfam:Sugar_tr 25 480 2.5e-103 PFAM
Pfam:MFS_1 321 502 3.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000067886
AA Change: F375I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063352
Gene: ENSMUSG00000005107
AA Change: F375I

DomainStartEndE-ValueType
Pfam:MFS_1 37 344 1.7e-16 PFAM
Pfam:Sugar_tr 40 495 9.8e-107 PFAM
Pfam:MFS_1 328 518 1.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122970
SMART Domains Protein: ENSMUSP00000117390
Gene: ENSMUSG00000005107

DomainStartEndE-ValueType
Pfam:MFS_1 28 269 7.5e-14 PFAM
Pfam:Sugar_tr 40 260 2e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129099
AA Change: F360I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122723
Gene: ENSMUSG00000005107
AA Change: F360I

DomainStartEndE-ValueType
Pfam:MFS_1 22 329 2.2e-16 PFAM
Pfam:Sugar_tr 25 480 2.5e-103 PFAM
Pfam:MFS_1 321 502 3.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143758
AA Change: F268I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118430
Gene: ENSMUSG00000005107
AA Change: F268I

DomainStartEndE-ValueType
Pfam:MFS_1 37 223 4.2e-10 PFAM
Pfam:Sugar_tr 40 203 1.2e-35 PFAM
Pfam:Sugar_tr 206 388 5.8e-39 PFAM
Pfam:MFS_1 209 411 2.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155634
AA Change: F360I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116354
Gene: ENSMUSG00000005107
AA Change: F360I

DomainStartEndE-ValueType
Pfam:MFS_1 22 329 2.2e-16 PFAM
Pfam:Sugar_tr 25 480 2.5e-103 PFAM
Pfam:MFS_1 321 502 3.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156272
AA Change: F152I

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000144374
Gene: ENSMUSG00000005107
AA Change: F152I

DomainStartEndE-ValueType
Pfam:Sugar_tr 40 111 4.5e-9 PFAM
transmembrane domain 140 157 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC2A facilitative glucose transporter family. Members of this family play a significant role in maintaining glucose homeostasis. The encoded protein may play a role in the development and survival of chondrocytes in cartilage matrices. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show partial prenatal lethality, polydipsia, hyperuricemia, hyperuricosuria and polyuria, and develop urate nephropathy, characterized by obstructive lithiasis, tubulointerstitial inflammation, cortical fibrosis, renal insufficiency and reduced male weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,598 L136P probably benign Het
4932438H23Rik T G 16: 91,055,612 Y212S probably damaging Het
Angpt1 T C 15: 42,512,399 N154D probably damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Ankrd27 T A 7: 35,601,626 L117* probably null Het
Arhgap21 C T 2: 20,854,180 M1234I probably benign Het
Arhgef33 A G 17: 80,367,335 E387G probably damaging Het
Atp13a4 T A 16: 29,454,769 K444* probably null Het
Atp6v1a G A 16: 44,101,862 R338C probably damaging Het
Canx T C 11: 50,311,647 D44G possibly damaging Het
Ccdc141 T A 2: 77,132,244 M119L probably benign Het
Ckmt1 A C 2: 121,362,691 Q299P possibly damaging Het
Dhx16 T C 17: 35,885,920 S601P probably damaging Het
Dna2 A C 10: 62,950,894 R140S probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Eogt A G 6: 97,143,998 S85P possibly damaging Het
Fbf1 A T 11: 116,165,881 M1K probably null Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flnb G A 14: 7,950,394 V2571I probably damaging Het
Gm11361 A G 13: 28,257,711 I26V probably benign Het
Gm43518 A G 5: 123,938,259 E123G unknown Het
Gm8332 T G 12: 88,249,685 E139A unknown Het
Gpatch2 A G 1: 187,304,355 N374S probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Hoxa11 T C 6: 52,245,802 probably benign Het
Hydin G A 8: 110,582,018 V3979I probably benign Het
Ighe C T 12: 113,271,793 W277* probably null Het
Kmt2c G T 5: 25,314,122 T2330K probably benign Het
Krt6a T A 15: 101,692,735 K261M probably damaging Het
Lats2 A C 14: 57,722,705 S161A probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Npepps A G 11: 97,244,426 probably null Het
Ntn4 A T 10: 93,741,104 N545Y possibly damaging Het
Olfr1501 A T 19: 13,838,402 M257K possibly damaging Het
Olfr164 T C 16: 19,286,701 D14G probably benign Het
Olfr353 A G 2: 36,890,354 S165P probably damaging Het
Olfr738 A C 14: 50,413,675 M44L probably benign Het
Osbpl2 T A 2: 180,155,343 V358E possibly damaging Het
Pdcd11 C A 19: 47,119,806 P1204Q probably damaging Het
Pnliprp2 A C 19: 58,763,374 S184R probably damaging Het
Ppm1g G T 5: 31,204,528 R373S probably damaging Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Setd5 T C 6: 113,121,087 S696P probably damaging Het
Sgip1 A G 4: 102,915,071 Q219R probably benign Het
Slc1a2 T C 2: 102,736,085 probably null Het
Slc22a12 T C 19: 6,542,437 T106A probably benign Het
Slc22a14 A G 9: 119,180,585 L148P probably damaging Het
Sorbs3 A T 14: 70,202,947 D117E probably benign Het
Sphkap G A 1: 83,276,500 T1176I probably damaging Het
Supt16 A T 14: 52,181,589 V193D probably damaging Het
Sytl3 A G 17: 6,728,291 T362A probably damaging Het
Tctn1 T A 5: 122,246,611 Q410L probably benign Het
Trbc2 T C 6: 41,547,777 Y133H Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r120 A G 17: 57,525,843 V112A probably benign Het
Zfp354b A T 11: 50,923,470 S209R probably benign Het
Zfp362 T C 4: 128,774,606 H391R probably damaging Het
Other mutations in Slc2a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02232:Slc2a9 APN 5 38436670 missense probably benign 0.19
IGL02505:Slc2a9 APN 5 38436659 missense possibly damaging 0.69
IGL03096:Slc2a9 APN 5 38351229 missense probably damaging 1.00
transporter9 UTSW 5 38382044 missense probably damaging 1.00
R0121:Slc2a9 UTSW 5 38398743 missense probably benign 0.00
R0395:Slc2a9 UTSW 5 38453169 missense probably damaging 1.00
R0599:Slc2a9 UTSW 5 38480144 start gained probably benign
R0610:Slc2a9 UTSW 5 38379942 missense probably damaging 1.00
R0993:Slc2a9 UTSW 5 38382063 missense probably damaging 1.00
R1166:Slc2a9 UTSW 5 38382041 critical splice donor site probably null
R1710:Slc2a9 UTSW 5 38382044 missense probably damaging 1.00
R2256:Slc2a9 UTSW 5 38453199 missense probably damaging 0.96
R2257:Slc2a9 UTSW 5 38453199 missense probably damaging 0.96
R4066:Slc2a9 UTSW 5 38483349 missense probably benign 0.03
R4193:Slc2a9 UTSW 5 38398706 missense probably damaging 1.00
R4502:Slc2a9 UTSW 5 38398811 missense probably benign 0.04
R4734:Slc2a9 UTSW 5 38382099 missense probably damaging 1.00
R4917:Slc2a9 UTSW 5 38417260 missense probably benign 0.01
R5218:Slc2a9 UTSW 5 38453181 missense probably damaging 1.00
R5885:Slc2a9 UTSW 5 38440674 missense probably damaging 1.00
R6313:Slc2a9 UTSW 5 38453121 missense probably benign 0.03
R6983:Slc2a9 UTSW 5 38391721 missense probably damaging 1.00
R7173:Slc2a9 UTSW 5 38452871 splice site probably null
R7286:Slc2a9 UTSW 5 38453195 missense probably damaging 0.99
R7405:Slc2a9 UTSW 5 38391824 missense probably damaging 1.00
R7573:Slc2a9 UTSW 5 38417226 missense probably damaging 1.00
R7594:Slc2a9 UTSW 5 38351291 missense probably benign 0.00
R8212:Slc2a9 UTSW 5 38480059 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAAGTTTCAGGGCCCATTG -3'
(R):5'- TGTCAAAGCAGCCCTCCATAG -3'

Sequencing Primer
(F):5'- ATTGCCAATGCCCCTCAGG -3'
(R):5'- ACCATCTGCCCAGGACTG -3'
Posted On2020-10-20