Incidental Mutation 'R8508:Hoxa11'
ID655695
Institutional Source Beutler Lab
Gene Symbol Hoxa11
Ensembl Gene ENSMUSG00000038210
Gene Namehomeobox A11
SynonymsHoxa-11, Hox-1.9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R8508 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location52242106-52245810 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 52245802 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048026] [ENSMUST00000121043]
Predicted Effect probably benign
Transcript: ENSMUST00000048026
SMART Domains Protein: ENSMUSP00000040920
Gene: ENSMUSG00000038210

DomainStartEndE-ValueType
Pfam:DUF3528 26 168 4.7e-67 PFAM
low complexity region 172 226 N/A INTRINSIC
HOX 241 303 9.56e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121043
SMART Domains Protein: ENSMUSP00000112872
Gene: ENSMUSG00000000938

DomainStartEndE-ValueType
HOX 20 82 1.15e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is located in a cluster of developmentally and temporally regulated genes on chromosome 6 encoding proteins involved in pattern formation. These proteins contain a characteristic DNA-binding motif called a homeodomain and function in transcriptional regulation. There are four distinct clusters of related genes on chromosomes 2, 6, 11, and 15. The protein encoded by this gene is important in the development of the skeleton, limbs, and urogenital tract. Expression of this gene may be regulated by overlapping transcription from an adjacent locus on the opposite strand (GeneID: 15397). [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit homeotic transformations affecting thoracic and sacral vertebrae, and forelimb defects. Mutants are sterile due to malformed vas deferens and cryptorchism in males, and defective uteri in females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,598 L136P probably benign Het
4932438H23Rik T G 16: 91,055,612 Y212S probably damaging Het
Angpt1 T C 15: 42,512,399 N154D probably damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Ankrd27 T A 7: 35,601,626 L117* probably null Het
Arhgap21 C T 2: 20,854,180 M1234I probably benign Het
Arhgef33 A G 17: 80,367,335 E387G probably damaging Het
Atp13a4 T A 16: 29,454,769 K444* probably null Het
Atp6v1a G A 16: 44,101,862 R338C probably damaging Het
Canx T C 11: 50,311,647 D44G possibly damaging Het
Ccdc141 T A 2: 77,132,244 M119L probably benign Het
Ckmt1 A C 2: 121,362,691 Q299P possibly damaging Het
Dhx16 T C 17: 35,885,920 S601P probably damaging Het
Dna2 A C 10: 62,950,894 R140S probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Eogt A G 6: 97,143,998 S85P possibly damaging Het
Fbf1 A T 11: 116,165,881 M1K probably null Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flnb G A 14: 7,950,394 V2571I probably damaging Het
Gm11361 A G 13: 28,257,711 I26V probably benign Het
Gm43518 A G 5: 123,938,259 E123G unknown Het
Gm8332 T G 12: 88,249,685 E139A unknown Het
Gpatch2 A G 1: 187,304,355 N374S probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Hydin G A 8: 110,582,018 V3979I probably benign Het
Ighe C T 12: 113,271,793 W277* probably null Het
Kmt2c G T 5: 25,314,122 T2330K probably benign Het
Krt6a T A 15: 101,692,735 K261M probably damaging Het
Lats2 A C 14: 57,722,705 S161A probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Npepps A G 11: 97,244,426 probably null Het
Ntn4 A T 10: 93,741,104 N545Y possibly damaging Het
Olfr1501 A T 19: 13,838,402 M257K possibly damaging Het
Olfr164 T C 16: 19,286,701 D14G probably benign Het
Olfr353 A G 2: 36,890,354 S165P probably damaging Het
Olfr738 A C 14: 50,413,675 M44L probably benign Het
Osbpl2 T A 2: 180,155,343 V358E possibly damaging Het
Pdcd11 C A 19: 47,119,806 P1204Q probably damaging Het
Pnliprp2 A C 19: 58,763,374 S184R probably damaging Het
Ppm1g G T 5: 31,204,528 R373S probably damaging Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Setd5 T C 6: 113,121,087 S696P probably damaging Het
Sgip1 A G 4: 102,915,071 Q219R probably benign Het
Slc1a2 T C 2: 102,736,085 probably null Het
Slc22a12 T C 19: 6,542,437 T106A probably benign Het
Slc22a14 A G 9: 119,180,585 L148P probably damaging Het
Slc2a9 A T 5: 38,382,078 F375I probably damaging Het
Sorbs3 A T 14: 70,202,947 D117E probably benign Het
Sphkap G A 1: 83,276,500 T1176I probably damaging Het
Supt16 A T 14: 52,181,589 V193D probably damaging Het
Sytl3 A G 17: 6,728,291 T362A probably damaging Het
Tctn1 T A 5: 122,246,611 Q410L probably benign Het
Trbc2 T C 6: 41,547,777 Y133H Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r120 A G 17: 57,525,843 V112A probably benign Het
Zfp354b A T 11: 50,923,470 S209R probably benign Het
Zfp362 T C 4: 128,774,606 H391R probably damaging Het
Other mutations in Hoxa11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02113:Hoxa11 APN 6 52245317 missense probably damaging 1.00
R1483:Hoxa11 UTSW 6 52243456 missense probably damaging 1.00
R4077:Hoxa11 UTSW 6 52245524 missense probably damaging 1.00
R4665:Hoxa11 UTSW 6 52243503 missense probably damaging 1.00
R5772:Hoxa11 UTSW 6 52245400 missense possibly damaging 0.46
R6195:Hoxa11 UTSW 6 52245701 missense probably damaging 1.00
R7593:Hoxa11 UTSW 6 52243544 missense probably damaging 1.00
R7681:Hoxa11 UTSW 6 52245119 missense probably benign
R7732:Hoxa11 UTSW 6 52243435 missense probably damaging 1.00
Z1177:Hoxa11 UTSW 6 52245110 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAAATCTGGACCCGAGACG -3'
(R):5'- ACGTGCTTTCGGTGAGAAC -3'

Sequencing Primer
(F):5'- CGTAGTAAGTACAACTTGGCAAATAC -3'
(R):5'- AACATCGGGTCACATGAC -3'
Posted On2020-10-20