Incidental Mutation 'R8508:Eogt'
ID655696
Institutional Source Beutler Lab
Gene Symbol Eogt
Ensembl Gene ENSMUSG00000035245
Gene NameEGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase
SynonymsA130022J15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R8508 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location97110024-97149182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97143998 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 85 (S85P)
Ref Sequence ENSEMBL: ENSMUSP00000061610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054344] [ENSMUST00000113387] [ENSMUST00000136575] [ENSMUST00000142116] [ENSMUST00000142553] [ENSMUST00000204331]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054344
AA Change: S85P

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000061610
Gene: ENSMUSG00000035245
AA Change: S85P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:DUF563 245 472 1.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113387
SMART Domains Protein: ENSMUSP00000109014
Gene: ENSMUSG00000035245

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000136575
AA Change: S85P

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117541
Gene: ENSMUSG00000035245
AA Change: S85P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142116
Predicted Effect possibly damaging
Transcript: ENSMUST00000142553
AA Change: S85P

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115101
Gene: ENSMUSG00000035245
AA Change: S85P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204331
SMART Domains Protein: ENSMUSP00000145303
Gene: ENSMUSG00000035245

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that acts in the lumen of the endoplasmic reticulum to catalyze the transfer of N-acetylglucosamine to serine or threonine residues of extracellular-targeted proteins. This enzyme modifies proteins containing eukaryotic growth factor (EGF)-like domains, including the Notch receptor, thereby regulating developmental signalling. Mutations in this gene have been observed in individuals with Adams-Oliver syndrome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,598 L136P probably benign Het
4932438H23Rik T G 16: 91,055,612 Y212S probably damaging Het
Angpt1 T C 15: 42,512,399 N154D probably damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Ankrd27 T A 7: 35,601,626 L117* probably null Het
Arhgap21 C T 2: 20,854,180 M1234I probably benign Het
Arhgef33 A G 17: 80,367,335 E387G probably damaging Het
Atp13a4 T A 16: 29,454,769 K444* probably null Het
Atp6v1a G A 16: 44,101,862 R338C probably damaging Het
Canx T C 11: 50,311,647 D44G possibly damaging Het
Ccdc141 T A 2: 77,132,244 M119L probably benign Het
Ckmt1 A C 2: 121,362,691 Q299P possibly damaging Het
Dhx16 T C 17: 35,885,920 S601P probably damaging Het
Dna2 A C 10: 62,950,894 R140S probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Fbf1 A T 11: 116,165,881 M1K probably null Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flnb G A 14: 7,950,394 V2571I probably damaging Het
Gm11361 A G 13: 28,257,711 I26V probably benign Het
Gm43518 A G 5: 123,938,259 E123G unknown Het
Gm8332 T G 12: 88,249,685 E139A unknown Het
Gpatch2 A G 1: 187,304,355 N374S probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Hoxa11 T C 6: 52,245,802 probably benign Het
Hydin G A 8: 110,582,018 V3979I probably benign Het
Ighe C T 12: 113,271,793 W277* probably null Het
Kmt2c G T 5: 25,314,122 T2330K probably benign Het
Krt6a T A 15: 101,692,735 K261M probably damaging Het
Lats2 A C 14: 57,722,705 S161A probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Npepps A G 11: 97,244,426 probably null Het
Ntn4 A T 10: 93,741,104 N545Y possibly damaging Het
Olfr1501 A T 19: 13,838,402 M257K possibly damaging Het
Olfr164 T C 16: 19,286,701 D14G probably benign Het
Olfr353 A G 2: 36,890,354 S165P probably damaging Het
Olfr738 A C 14: 50,413,675 M44L probably benign Het
Osbpl2 T A 2: 180,155,343 V358E possibly damaging Het
Pdcd11 C A 19: 47,119,806 P1204Q probably damaging Het
Pnliprp2 A C 19: 58,763,374 S184R probably damaging Het
Ppm1g G T 5: 31,204,528 R373S probably damaging Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Setd5 T C 6: 113,121,087 S696P probably damaging Het
Sgip1 A G 4: 102,915,071 Q219R probably benign Het
Slc1a2 T C 2: 102,736,085 probably null Het
Slc22a12 T C 19: 6,542,437 T106A probably benign Het
Slc22a14 A G 9: 119,180,585 L148P probably damaging Het
Slc2a9 A T 5: 38,382,078 F375I probably damaging Het
Sorbs3 A T 14: 70,202,947 D117E probably benign Het
Sphkap G A 1: 83,276,500 T1176I probably damaging Het
Supt16 A T 14: 52,181,589 V193D probably damaging Het
Sytl3 A G 17: 6,728,291 T362A probably damaging Het
Tctn1 T A 5: 122,246,611 Q410L probably benign Het
Trbc2 T C 6: 41,547,777 Y133H Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r120 A G 17: 57,525,843 V112A probably benign Het
Zfp354b A T 11: 50,923,470 S209R probably benign Het
Zfp362 T C 4: 128,774,606 H391R probably damaging Het
Other mutations in Eogt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Eogt APN 6 97120000 missense probably damaging 0.97
IGL01292:Eogt APN 6 97144027 missense possibly damaging 0.88
IGL02332:Eogt APN 6 97125605 missense probably damaging 1.00
IGL02439:Eogt APN 6 97143973 missense possibly damaging 0.83
disappointment UTSW 6 97143965 missense probably benign 0.00
Underachiever UTSW 6 97120201 missense probably benign 0.01
R0019:Eogt UTSW 6 97134273 unclassified probably benign
R0112:Eogt UTSW 6 97135284 splice site probably benign
R0325:Eogt UTSW 6 97113955 missense probably damaging 0.99
R0497:Eogt UTSW 6 97135233 missense probably benign 0.00
R0730:Eogt UTSW 6 97116009 nonsense probably null
R1730:Eogt UTSW 6 97113864 missense probably damaging 1.00
R1783:Eogt UTSW 6 97113864 missense probably damaging 1.00
R2074:Eogt UTSW 6 97131376 missense probably benign 0.02
R2279:Eogt UTSW 6 97134301 missense probably benign 0.28
R2679:Eogt UTSW 6 97120800 missense probably benign 0.01
R2993:Eogt UTSW 6 97118954 splice site probably null
R3176:Eogt UTSW 6 97131394 missense probably benign 0.21
R3276:Eogt UTSW 6 97131394 missense probably benign 0.21
R3876:Eogt UTSW 6 97120190 missense probably damaging 0.99
R3940:Eogt UTSW 6 97113914 missense probably damaging 1.00
R4613:Eogt UTSW 6 97134304 missense probably benign 0.00
R4704:Eogt UTSW 6 97113852 missense probably damaging 0.99
R4849:Eogt UTSW 6 97116055 missense probably damaging 0.99
R4867:Eogt UTSW 6 97120147 intron probably benign
R4905:Eogt UTSW 6 97142831 missense probably benign 0.01
R5120:Eogt UTSW 6 97134315 missense probably benign
R5143:Eogt UTSW 6 97125584 missense probably damaging 1.00
R5594:Eogt UTSW 6 97116035 missense probably benign 0.01
R6351:Eogt UTSW 6 97120194 missense probably damaging 1.00
R6418:Eogt UTSW 6 97145392 missense possibly damaging 0.77
R6498:Eogt UTSW 6 97135213 missense probably damaging 1.00
R6950:Eogt UTSW 6 97134382 missense possibly damaging 0.77
R7114:Eogt UTSW 6 97116004 missense probably damaging 1.00
R7185:Eogt UTSW 6 97120178 missense probably damaging 1.00
R7221:Eogt UTSW 6 97112724 missense probably damaging 1.00
R7232:Eogt UTSW 6 97119983 missense probably damaging 0.98
R7467:Eogt UTSW 6 97142833 missense probably benign 0.01
R7526:Eogt UTSW 6 97113952 missense probably damaging 1.00
R7672:Eogt UTSW 6 97113909 missense probably damaging 1.00
R7851:Eogt UTSW 6 97120201 missense probably benign 0.01
R7956:Eogt UTSW 6 97143965 missense probably benign 0.00
R8021:Eogt UTSW 6 97134330 missense probably damaging 1.00
R8475:Eogt UTSW 6 97145366 nonsense probably null
R8550:Eogt UTSW 6 97112072 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CCTGGATAAGCAAATTAGCATCTG -3'
(R):5'- TGTGGAGACTCTTGAGCCTG -3'

Sequencing Primer
(F):5'- GCAAATTAGCATCTGCAGGTC -3'
(R):5'- GCCCCTCTCAGAATGTTATGAG -3'
Posted On2020-10-20