Incidental Mutation 'R8508:Fbxl12'
ID655702
Institutional Source Beutler Lab
Gene Symbol Fbxl12
Ensembl Gene ENSMUSG00000066892
Gene NameF-box and leucine-rich repeat protein 12
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8508 (G1)
Quality Score195.009
Status Not validated
Chromosome9
Chromosomal Location20618118-20644767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20638864 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 165 (R165L)
Ref Sequence ENSEMBL: ENSMUSP00000083650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086458] [ENSMUST00000086459] [ENSMUST00000129414] [ENSMUST00000131128] [ENSMUST00000131343] [ENSMUST00000140702] [ENSMUST00000148631] [ENSMUST00000151861] [ENSMUST00000155301]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086458
AA Change: R112L

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083649
Gene: ENSMUSG00000066892
AA Change: R112L

DomainStartEndE-ValueType
SCOP:d1fqva2 50 238 4e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000086459
AA Change: R165L

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083650
Gene: ENSMUSG00000066892
AA Change: R165L

DomainStartEndE-ValueType
FBOX 7 46 1.14e-8 SMART
SCOP:d1fqva2 103 291 5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129414
SMART Domains Protein: ENSMUSP00000123971
Gene: ENSMUSG00000084786

DomainStartEndE-ValueType
Pfam:Ubiquitin_2 2 71 6.3e-7 PFAM
Pfam:ubiquitin 8 73 7.6e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131128
AA Change: R112L

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115058
Gene: ENSMUSG00000066892
AA Change: R112L

DomainStartEndE-ValueType
SCOP:d1fqva2 50 238 4e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131343
AA Change: R112L

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000140702
AA Change: R112L

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114466
Gene: ENSMUSG00000066892
AA Change: R112L

DomainStartEndE-ValueType
SCOP:d1fqva2 50 238 4e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000148631
AA Change: R165L

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119124
Gene: ENSMUSG00000066892
AA Change: R165L

DomainStartEndE-ValueType
FBOX 7 46 1.14e-8 SMART
SCOP:d1fqva2 103 291 5e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151861
AA Change: R188L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121429
Gene: ENSMUSG00000066892
AA Change: R188L

DomainStartEndE-ValueType
SCOP:d1fqva2 50 238 4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155301
SMART Domains Protein: ENSMUSP00000118369
Gene: ENSMUSG00000066892

DomainStartEndE-ValueType
FBOX 7 46 1.14e-8 SMART
low complexity region 65 76 N/A INTRINSIC
Meta Mutation Damage Score 0.2169 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL12, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, growth retardation, small placenta, absent gastric milk in mice that die and abnormal placental. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,598 L136P probably benign Het
4932438H23Rik T G 16: 91,055,612 Y212S probably damaging Het
Angpt1 T C 15: 42,512,399 N154D probably damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Ankrd27 T A 7: 35,601,626 L117* probably null Het
Arhgap21 C T 2: 20,854,180 M1234I probably benign Het
Arhgef33 A G 17: 80,367,335 E387G probably damaging Het
Atp13a4 T A 16: 29,454,769 K444* probably null Het
Atp6v1a G A 16: 44,101,862 R338C probably damaging Het
Canx T C 11: 50,311,647 D44G possibly damaging Het
Ccdc141 T A 2: 77,132,244 M119L probably benign Het
Ckmt1 A C 2: 121,362,691 Q299P possibly damaging Het
Dhx16 T C 17: 35,885,920 S601P probably damaging Het
Dna2 A C 10: 62,950,894 R140S probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Eogt A G 6: 97,143,998 S85P possibly damaging Het
Fbf1 A T 11: 116,165,881 M1K probably null Het
Flnb G A 14: 7,950,394 V2571I probably damaging Het
Gm11361 A G 13: 28,257,711 I26V probably benign Het
Gm43518 A G 5: 123,938,259 E123G unknown Het
Gm8332 T G 12: 88,249,685 E139A unknown Het
Gpatch2 A G 1: 187,304,355 N374S probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Hoxa11 T C 6: 52,245,802 probably benign Het
Hydin G A 8: 110,582,018 V3979I probably benign Het
Ighe C T 12: 113,271,793 W277* probably null Het
Kmt2c G T 5: 25,314,122 T2330K probably benign Het
Krt6a T A 15: 101,692,735 K261M probably damaging Het
Lats2 A C 14: 57,722,705 S161A probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Npepps A G 11: 97,244,426 probably null Het
Ntn4 A T 10: 93,741,104 N545Y possibly damaging Het
Olfr1501 A T 19: 13,838,402 M257K possibly damaging Het
Olfr164 T C 16: 19,286,701 D14G probably benign Het
Olfr353 A G 2: 36,890,354 S165P probably damaging Het
Olfr738 A C 14: 50,413,675 M44L probably benign Het
Osbpl2 T A 2: 180,155,343 V358E possibly damaging Het
Pdcd11 C A 19: 47,119,806 P1204Q probably damaging Het
Pnliprp2 A C 19: 58,763,374 S184R probably damaging Het
Ppm1g G T 5: 31,204,528 R373S probably damaging Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Setd5 T C 6: 113,121,087 S696P probably damaging Het
Sgip1 A G 4: 102,915,071 Q219R probably benign Het
Slc1a2 T C 2: 102,736,085 probably null Het
Slc22a12 T C 19: 6,542,437 T106A probably benign Het
Slc22a14 A G 9: 119,180,585 L148P probably damaging Het
Slc2a9 A T 5: 38,382,078 F375I probably damaging Het
Sorbs3 A T 14: 70,202,947 D117E probably benign Het
Sphkap G A 1: 83,276,500 T1176I probably damaging Het
Supt16 A T 14: 52,181,589 V193D probably damaging Het
Sytl3 A G 17: 6,728,291 T362A probably damaging Het
Tctn1 T A 5: 122,246,611 Q410L probably benign Het
Trbc2 T C 6: 41,547,777 Y133H Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r120 A G 17: 57,525,843 V112A probably benign Het
Zfp354b A T 11: 50,923,470 S209R probably benign Het
Zfp362 T C 4: 128,774,606 H391R probably damaging Het
Other mutations in Fbxl12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01554:Fbxl12 APN 9 20638919 missense possibly damaging 0.89
R0329:Fbxl12 UTSW 9 20638480 missense probably damaging 0.96
R2327:Fbxl12 UTSW 9 20642234 missense probably damaging 1.00
R2919:Fbxl12 UTSW 9 20642213 missense probably damaging 1.00
R3722:Fbxl12 UTSW 9 20638972 splice site probably null
R5322:Fbxl12 UTSW 9 20639008 missense probably damaging 1.00
R6266:Fbxl12 UTSW 9 20638615 missense probably damaging 1.00
R6392:Fbxl12 UTSW 9 20639176 missense probably damaging 0.98
R7017:Fbxl12 UTSW 9 20618320 missense unknown
R7131:Fbxl12 UTSW 9 20644383 unclassified probably benign
R7213:Fbxl12 UTSW 9 20639008 missense probably damaging 1.00
R7238:Fbxl12 UTSW 9 20618413 splice site probably null
R8270:Fbxl12 UTSW 9 20638864 missense possibly damaging 0.90
R8272:Fbxl12 UTSW 9 20638864 missense possibly damaging 0.90
R8273:Fbxl12 UTSW 9 20638864 missense possibly damaging 0.90
R8283:Fbxl12 UTSW 9 20638721 missense probably benign 0.00
R8423:Fbxl12 UTSW 9 20638864 missense possibly damaging 0.90
R8510:Fbxl12 UTSW 9 20638864 missense possibly damaging 0.90
R8526:Fbxl12 UTSW 9 20638864 missense possibly damaging 0.90
R8527:Fbxl12 UTSW 9 20638864 missense possibly damaging 0.90
R8528:Fbxl12 UTSW 9 20638864 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCTTGCGCACATCTCGAAG -3'
(R):5'- AAATGCCCCAATCTGAAGCG -3'

Sequencing Primer
(F):5'- ACATCTCGAAGGTGGCGG -3'
(R):5'- AATCTGAAGCGCCTGTGC -3'
Posted On2020-10-20