Incidental Mutation 'R8508:Rnf130'
ID655706
Institutional Source Beutler Lab
Gene Symbol Rnf130
Ensembl Gene ENSMUSG00000020376
Gene Namering finger protein 130
SynonymsG1RZFP, G1RP, 2510042A13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R8508 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location50025346-50104758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50087437 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 275 (D275G)
Ref Sequence ENSEMBL: ENSMUSP00000099837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054684] [ENSMUST00000102776]
Predicted Effect probably damaging
Transcript: ENSMUST00000054684
AA Change: D275G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056345
Gene: ENSMUSG00000020376
AA Change: D275G

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:PA 65 169 4.6e-13 PFAM
transmembrane domain 195 217 N/A INTRINSIC
RING 264 304 5.51e-7 SMART
low complexity region 341 354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102776
AA Change: D275G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099837
Gene: ENSMUSG00000020376
AA Change: D275G

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
Pfam:PA 69 167 8.1e-14 PFAM
transmembrane domain 195 217 N/A INTRINSIC
RING 264 304 5.51e-7 SMART
low complexity region 341 354 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger motif and is similar to g1, a Drosophila zinc-finger protein that is expressed in mesoderm and involved in embryonic development. The expression of the mouse counterpart was found to be upregulated in myeloblastic cells following IL3 deprivation, suggesting that this gene may regulate growth factor withdrawal-induced apoptosis of myeloid precursor cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,598 L136P probably benign Het
4932438H23Rik T G 16: 91,055,612 Y212S probably damaging Het
Angpt1 T C 15: 42,512,399 N154D probably damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Ankrd27 T A 7: 35,601,626 L117* probably null Het
Arhgap21 C T 2: 20,854,180 M1234I probably benign Het
Arhgef33 A G 17: 80,367,335 E387G probably damaging Het
Atp13a4 T A 16: 29,454,769 K444* probably null Het
Atp6v1a G A 16: 44,101,862 R338C probably damaging Het
Canx T C 11: 50,311,647 D44G possibly damaging Het
Ccdc141 T A 2: 77,132,244 M119L probably benign Het
Ckmt1 A C 2: 121,362,691 Q299P possibly damaging Het
Dhx16 T C 17: 35,885,920 S601P probably damaging Het
Dna2 A C 10: 62,950,894 R140S probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Eogt A G 6: 97,143,998 S85P possibly damaging Het
Fbf1 A T 11: 116,165,881 M1K probably null Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flnb G A 14: 7,950,394 V2571I probably damaging Het
Gm11361 A G 13: 28,257,711 I26V probably benign Het
Gm43518 A G 5: 123,938,259 E123G unknown Het
Gm8332 T G 12: 88,249,685 E139A unknown Het
Gpatch2 A G 1: 187,304,355 N374S probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Hoxa11 T C 6: 52,245,802 probably benign Het
Hydin G A 8: 110,582,018 V3979I probably benign Het
Ighe C T 12: 113,271,793 W277* probably null Het
Kmt2c G T 5: 25,314,122 T2330K probably benign Het
Krt6a T A 15: 101,692,735 K261M probably damaging Het
Lats2 A C 14: 57,722,705 S161A probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Npepps A G 11: 97,244,426 probably null Het
Ntn4 A T 10: 93,741,104 N545Y possibly damaging Het
Olfr1501 A T 19: 13,838,402 M257K possibly damaging Het
Olfr164 T C 16: 19,286,701 D14G probably benign Het
Olfr353 A G 2: 36,890,354 S165P probably damaging Het
Olfr738 A C 14: 50,413,675 M44L probably benign Het
Osbpl2 T A 2: 180,155,343 V358E possibly damaging Het
Pdcd11 C A 19: 47,119,806 P1204Q probably damaging Het
Pnliprp2 A C 19: 58,763,374 S184R probably damaging Het
Ppm1g G T 5: 31,204,528 R373S probably damaging Het
Setd5 T C 6: 113,121,087 S696P probably damaging Het
Sgip1 A G 4: 102,915,071 Q219R probably benign Het
Slc1a2 T C 2: 102,736,085 probably null Het
Slc22a12 T C 19: 6,542,437 T106A probably benign Het
Slc22a14 A G 9: 119,180,585 L148P probably damaging Het
Slc2a9 A T 5: 38,382,078 F375I probably damaging Het
Sorbs3 A T 14: 70,202,947 D117E probably benign Het
Sphkap G A 1: 83,276,500 T1176I probably damaging Het
Supt16 A T 14: 52,181,589 V193D probably damaging Het
Sytl3 A G 17: 6,728,291 T362A probably damaging Het
Tctn1 T A 5: 122,246,611 Q410L probably benign Het
Trbc2 T C 6: 41,547,777 Y133H Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r120 A G 17: 57,525,843 V112A probably benign Het
Zfp354b A T 11: 50,923,470 S209R probably benign Het
Zfp362 T C 4: 128,774,606 H391R probably damaging Het
Other mutations in Rnf130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Rnf130 APN 11 50093796 missense probably damaging 1.00
IGL02364:Rnf130 APN 11 50095840 missense probably benign
IGL02948:Rnf130 APN 11 50052771 splice site probably benign
R0145:Rnf130 UTSW 11 50071219 missense possibly damaging 0.89
R0358:Rnf130 UTSW 11 50071282 missense probably benign 0.01
R0570:Rnf130 UTSW 11 50095876 missense possibly damaging 0.66
R0786:Rnf130 UTSW 11 50087437 missense probably damaging 1.00
R1709:Rnf130 UTSW 11 50087386 missense possibly damaging 0.80
R2312:Rnf130 UTSW 11 50087463 critical splice donor site probably null
R2972:Rnf130 UTSW 11 50093800 nonsense probably null
R4353:Rnf130 UTSW 11 50087440 missense possibly damaging 0.83
R4398:Rnf130 UTSW 11 50071378 missense probably benign 0.08
R5162:Rnf130 UTSW 11 50052895 missense probably damaging 1.00
R5236:Rnf130 UTSW 11 50095978 missense probably damaging 0.99
R5869:Rnf130 UTSW 11 50085815 splice site probably null
R6432:Rnf130 UTSW 11 50095790 nonsense probably null
R6865:Rnf130 UTSW 11 50071264 missense probably damaging 1.00
R8209:Rnf130 UTSW 11 50071270 missense probably benign 0.44
R8226:Rnf130 UTSW 11 50071270 missense probably benign 0.44
R8293:Rnf130 UTSW 11 50095796 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCTCCGGCTTAATGTAAGACAC -3'
(R):5'- CTGGAGAGGAATTCTGGTCAG -3'

Sequencing Primer
(F):5'- TGGCTCATATGTAATTTGGATCAAC -3'
(R):5'- GTCAGAGTTGACCAAGACCTTC -3'
Posted On2020-10-20