Mutagenetix > Incidental Mutations

Incidental Mutation 'R8508:Canx'

655707

Institutional Source

Beutler Lab

Gene Symbol

Canx

Ensembl Gene

ENSMUSG00000020368

Gene Name

calnexin

Synonyms

1110069N15Rik, CNX

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.935) question?

Stock #

R8508 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

50293961-50325673 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 50311647 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 44 (D44G)

Ref Sequence

ENSEMBL: ENSMUSP00000020637 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020637] [ENSMUST00000179865]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020637
AA Change: D44G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000020637
Gene: ENSMUSG00000020368
AA Change: D44G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Calreticulin	72	441	1.7e-170	PFAM
transmembrane domain	484	506	N/A	INTRINSIC
coiled coil region	525	560	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000179865
AA Change: D44G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000137440
Gene: ENSMUSG00000020368
AA Change: D44G

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Calreticulin	70	441	4.7e-166	PFAM
transmembrane domain	484	506	N/A	INTRINSIC
coiled coil region	525	560	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calnexin family of molecular chaperones. The encoded protein is a calcium-binding, endoplasmic reticulum (ER)-associated protein that interacts transiently with newly synthesized N-linked glycoproteins, facilitating protein folding and assembly. It may also play a central role in the quality control of protein folding by retaining incorrectly folded protein subunits within the ER for degradation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit motor defects, loss of large myelinated nerve fibers, small size, and very high mortality between birth and 4 weeks of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,743,598	L136P	probably benign	Het
4932438H23Rik	T	G	16: 91,055,612	Y212S	probably damaging	Het
Angpt1	T	C	15: 42,512,399	N154D	probably damaging	Het
Angpt2	G	A	8: 18,741,119	R54*	probably null	Het
Ankrd27	T	A	7: 35,601,626	L117*	probably null	Het
Arhgap21	C	T	2: 20,854,180	M1234I	probably benign	Het
Arhgef33	A	G	17: 80,367,335	E387G	probably damaging	Het
Atp13a4	T	A	16: 29,454,769	K444*	probably null	Het
Atp6v1a	G	A	16: 44,101,862	R338C	probably damaging	Het
Ccdc141	T	A	2: 77,132,244	M119L	probably benign	Het
Ckmt1	A	C	2: 121,362,691	Q299P	possibly damaging	Het
Dhx16	T	C	17: 35,885,920	S601P	probably damaging	Het
Dna2	A	C	10: 62,950,894	R140S	probably damaging	Het
Dock1	A	G	7: 134,782,409	T670A	probably benign	Het
Eogt	A	G	6: 97,143,998	S85P	possibly damaging	Het
Fbf1	A	T	11: 116,165,881	M1K	probably null	Het
Fbxl12	C	A	9: 20,638,864	R165L	possibly damaging	Het
Flnb	G	A	14: 7,950,394	V2571I	probably damaging	Het
Gm11361	A	G	13: 28,257,711	I26V	probably benign	Het
Gm43518	A	G	5: 123,938,259	E123G	unknown	Het
Gm8332	T	G	12: 88,249,685	E139A	unknown	Het
Gpatch2	A	G	1: 187,304,355	N374S	probably benign	Het
Hey1	G	C	3: 8,664,776	A207G	probably benign	Het
Hoxa11	T	C	6: 52,245,802		probably benign	Het
Hydin	G	A	8: 110,582,018	V3979I	probably benign	Het
Ighe	C	T	12: 113,271,793	W277*	probably null	Het
Kmt2c	G	T	5: 25,314,122	T2330K	probably benign	Het
Krt6a	T	A	15: 101,692,735	K261M	probably damaging	Het
Lats2	A	C	14: 57,722,705	S161A	probably benign	Het
Med13l	T	A	5: 118,754,321	D1936E	probably benign	Het
Mipol1	T	C	12: 57,306,088	V71A	possibly damaging	Het
Mphosph8	A	T	14: 56,676,546	K415*	probably null	Het
Npepps	A	G	11: 97,244,426		probably null	Het
Ntn4	A	T	10: 93,741,104	N545Y	possibly damaging	Het
Olfr1501	A	T	19: 13,838,402	M257K	possibly damaging	Het
Olfr164	T	C	16: 19,286,701	D14G	probably benign	Het
Olfr353	A	G	2: 36,890,354	S165P	probably damaging	Het
Olfr738	A	C	14: 50,413,675	M44L	probably benign	Het
Osbpl2	T	A	2: 180,155,343	V358E	possibly damaging	Het
Pdcd11	C	A	19: 47,119,806	P1204Q	probably damaging	Het
Pnliprp2	A	C	19: 58,763,374	S184R	probably damaging	Het
Ppm1g	G	T	5: 31,204,528	R373S	probably damaging	Het
Rnf130	A	G	11: 50,087,437	D275G	probably damaging	Het
Setd5	T	C	6: 113,121,087	S696P	probably damaging	Het
Sgip1	A	G	4: 102,915,071	Q219R	probably benign	Het
Slc1a2	T	C	2: 102,736,085		probably null	Het
Slc22a12	T	C	19: 6,542,437	T106A	probably benign	Het
Slc22a14	A	G	9: 119,180,585	L148P	probably damaging	Het
Slc2a9	A	T	5: 38,382,078	F375I	probably damaging	Het
Sorbs3	A	T	14: 70,202,947	D117E	probably benign	Het
Sphkap	G	A	1: 83,276,500	T1176I	probably damaging	Het
Supt16	A	T	14: 52,181,589	V193D	probably damaging	Het
Sytl3	A	G	17: 6,728,291	T362A	probably damaging	Het
Tctn1	T	A	5: 122,246,611	Q410L	probably benign	Het
Trbc2	T	C	6: 41,547,777	Y133H		Het
Ttc28	G	A	5: 111,233,341	D1240N	probably benign	Het
Vmn2r120	A	G	17: 57,525,843	V112A	probably benign	Het
Zfp354b	A	T	11: 50,923,470	S209R	probably benign	Het
Zfp362	T	C	4: 128,774,606	H391R	probably damaging	Het

Other mutations in Canx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00675:Canx	APN	11	50300996	missense	possibly damaging	0.61
IGL03089:Canx	APN	11	50304482	missense	possibly damaging	0.85
R1428:Canx	UTSW	11	50308394	splice site	probably benign
R1876:Canx	UTSW	11	50304359	missense	probably damaging	1.00
R2057:Canx	UTSW	11	50304425	missense	probably damaging	0.97
R2058:Canx	UTSW	11	50304425	missense	probably damaging	0.97
R2088:Canx	UTSW	11	50310390	missense	possibly damaging	0.89
R2126:Canx	UTSW	11	50304358	missense	probably damaging	1.00
R2217:Canx	UTSW	11	50310867	missense	probably benign	0.24
R2218:Canx	UTSW	11	50310867	missense	probably benign	0.24
R2386:Canx	UTSW	11	50297106	missense	probably benign
R3716:Canx	UTSW	11	50304474	missense	probably benign	0.14
R3957:Canx	UTSW	11	50308383	missense	probably damaging	1.00
R4019:Canx	UTSW	11	50299245	missense	probably damaging	1.00
R4402:Canx	UTSW	11	50304438	missense	probably benign	0.13
R4825:Canx	UTSW	11	50308809	missense	probably benign	0.42
R5252:Canx	UTSW	11	50308794	missense	probably damaging	1.00
R5385:Canx	UTSW	11	50301812	missense	probably damaging	1.00
R5797:Canx	UTSW	11	50301017	missense	probably benign	0.00
R5820:Canx	UTSW	11	50308383	missense	probably damaging	1.00
R6052:Canx	UTSW	11	50297119	missense	possibly damaging	0.49
R7259:Canx	UTSW	11	50301816	missense	probably damaging	1.00
R7603:Canx	UTSW	11	50311628	missense	probably benign
R7715:Canx	UTSW	11	50310804	missense	probably benign	0.13
R7735:Canx	UTSW	11	50301039	missense	probably damaging	0.97
R8063:Canx	UTSW	11	50308346	nonsense	probably null
R8069:Canx	UTSW	11	50311704	missense	possibly damaging	0.93
R8494:Canx	UTSW	11	50311782	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTAACTATATATCCCCAGCCTCTG -3'
(R):5'- TGGGAAACAGTACATTTCACATTCC -3'

Sequencing Primer
(F):5'- CTCTGGAAGAGCAGTCAGTACTC -3'
(R):5'- CCTTCCAAATGCTGGGATTACAGG -3'

Posted On

2020-10-20