Incidental Mutation 'R8508:Mipol1'
ID655711
Institutional Source Beutler Lab
Gene Symbol Mipol1
Ensembl Gene ENSMUSG00000047022
Gene Namemirror-image polydactyly 1
Synonyms1700081O04Rik, 6030439O22Rik, D12Ertd19e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8508 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location57230427-57497199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57306088 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 71 (V71A)
Ref Sequence ENSEMBL: ENSMUSP00000117005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123498] [ENSMUST00000130447] [ENSMUST00000145003] [ENSMUST00000153137]
Predicted Effect probably benign
Transcript: ENSMUST00000123498
AA Change: V71A

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119636
Gene: ENSMUSG00000047022
AA Change: V71A

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130447
AA Change: V71A

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119918
Gene: ENSMUSG00000047022
AA Change: V71A

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136006
Predicted Effect probably benign
Transcript: ENSMUST00000145003
AA Change: V71A

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121617
Gene: ENSMUSG00000047022
AA Change: V71A

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150292
Predicted Effect possibly damaging
Transcript: ENSMUST00000153137
AA Change: V71A

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117005
Gene: ENSMUSG00000047022
AA Change: V71A

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153755
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein may function as a tumor suppressor. A translocation that results in truncation of the protein encoded by this locus has been associated with mirror-image polydactyly, also known as Laurin-Sandrow Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,598 L136P probably benign Het
4932438H23Rik T G 16: 91,055,612 Y212S probably damaging Het
Angpt1 T C 15: 42,512,399 N154D probably damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Ankrd27 T A 7: 35,601,626 L117* probably null Het
Arhgap21 C T 2: 20,854,180 M1234I probably benign Het
Arhgef33 A G 17: 80,367,335 E387G probably damaging Het
Atp13a4 T A 16: 29,454,769 K444* probably null Het
Atp6v1a G A 16: 44,101,862 R338C probably damaging Het
Canx T C 11: 50,311,647 D44G possibly damaging Het
Ccdc141 T A 2: 77,132,244 M119L probably benign Het
Ckmt1 A C 2: 121,362,691 Q299P possibly damaging Het
Dhx16 T C 17: 35,885,920 S601P probably damaging Het
Dna2 A C 10: 62,950,894 R140S probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Eogt A G 6: 97,143,998 S85P possibly damaging Het
Fbf1 A T 11: 116,165,881 M1K probably null Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flnb G A 14: 7,950,394 V2571I probably damaging Het
Gm11361 A G 13: 28,257,711 I26V probably benign Het
Gm43518 A G 5: 123,938,259 E123G unknown Het
Gm8332 T G 12: 88,249,685 E139A unknown Het
Gpatch2 A G 1: 187,304,355 N374S probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Hoxa11 T C 6: 52,245,802 probably benign Het
Hydin G A 8: 110,582,018 V3979I probably benign Het
Ighe C T 12: 113,271,793 W277* probably null Het
Kmt2c G T 5: 25,314,122 T2330K probably benign Het
Krt6a T A 15: 101,692,735 K261M probably damaging Het
Lats2 A C 14: 57,722,705 S161A probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Npepps A G 11: 97,244,426 probably null Het
Ntn4 A T 10: 93,741,104 N545Y possibly damaging Het
Olfr1501 A T 19: 13,838,402 M257K possibly damaging Het
Olfr164 T C 16: 19,286,701 D14G probably benign Het
Olfr353 A G 2: 36,890,354 S165P probably damaging Het
Olfr738 A C 14: 50,413,675 M44L probably benign Het
Osbpl2 T A 2: 180,155,343 V358E possibly damaging Het
Pdcd11 C A 19: 47,119,806 P1204Q probably damaging Het
Pnliprp2 A C 19: 58,763,374 S184R probably damaging Het
Ppm1g G T 5: 31,204,528 R373S probably damaging Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Setd5 T C 6: 113,121,087 S696P probably damaging Het
Sgip1 A G 4: 102,915,071 Q219R probably benign Het
Slc1a2 T C 2: 102,736,085 probably null Het
Slc22a12 T C 19: 6,542,437 T106A probably benign Het
Slc22a14 A G 9: 119,180,585 L148P probably damaging Het
Slc2a9 A T 5: 38,382,078 F375I probably damaging Het
Sorbs3 A T 14: 70,202,947 D117E probably benign Het
Sphkap G A 1: 83,276,500 T1176I probably damaging Het
Supt16 A T 14: 52,181,589 V193D probably damaging Het
Sytl3 A G 17: 6,728,291 T362A probably damaging Het
Tctn1 T A 5: 122,246,611 Q410L probably benign Het
Trbc2 T C 6: 41,547,777 Y133H Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r120 A G 17: 57,525,843 V112A probably benign Het
Zfp354b A T 11: 50,923,470 S209R probably benign Het
Zfp362 T C 4: 128,774,606 H391R probably damaging Het
Other mutations in Mipol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Mipol1 APN 12 57307353 splice site probably benign
IGL01139:Mipol1 APN 12 57306035 nonsense probably null
IGL02679:Mipol1 APN 12 57306043 missense possibly damaging 0.84
IGL03109:Mipol1 APN 12 57364224 missense probably benign 0.20
R0001:Mipol1 UTSW 12 57460839 splice site probably benign
R0220:Mipol1 UTSW 12 57457150 missense probably damaging 1.00
R0271:Mipol1 UTSW 12 57460954 unclassified probably benign
R0284:Mipol1 UTSW 12 57457069 missense probably damaging 0.98
R0496:Mipol1 UTSW 12 57457177 missense probably damaging 0.99
R0538:Mipol1 UTSW 12 57414411 critical splice donor site probably null
R1082:Mipol1 UTSW 12 57325616 missense probably damaging 0.98
R1552:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R1558:Mipol1 UTSW 12 57332341 missense probably damaging 1.00
R1928:Mipol1 UTSW 12 57332419 missense probably damaging 1.00
R2104:Mipol1 UTSW 12 57306056 splice site probably null
R2495:Mipol1 UTSW 12 57460990 splice site probably benign
R3723:Mipol1 UTSW 12 57457092 missense probably damaging 1.00
R4431:Mipol1 UTSW 12 57303524 missense possibly damaging 0.58
R4447:Mipol1 UTSW 12 57352748 intron probably benign
R4654:Mipol1 UTSW 12 57306132 missense probably benign 0.22
R4847:Mipol1 UTSW 12 57303496 missense probably damaging 0.99
R4851:Mipol1 UTSW 12 57332301 missense probably damaging 1.00
R5113:Mipol1 UTSW 12 57496499 missense probably benign 0.36
R5668:Mipol1 UTSW 12 57325560 missense possibly damaging 0.48
R6535:Mipol1 UTSW 12 57306100 missense possibly damaging 0.95
R7172:Mipol1 UTSW 12 57325535 missense possibly damaging 0.95
R7191:Mipol1 UTSW 12 57457066 missense probably benign 0.01
R7560:Mipol1 UTSW 12 57306073 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACCGGAGTCTCTTTTGGGAT -3'
(R):5'- ACACAAAGCGACCATTGAAGAATT -3'

Sequencing Primer
(F):5'- CCGGAGTCTCTTTTGGGATCACTG -3'
(R):5'- GCGACCATTGAAGAATTAAAACATG -3'
Posted On2020-10-20