Incidental Mutation 'R8508:Ighe'
ID655713
Institutional Source Beutler Lab
Gene Symbol Ighe
Ensembl Gene ENSMUSG00000087642
Gene NameImmunoglobulin heavy constant epsilon
SynonymsGm900, LOC380792
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R8508 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location113271174-113273248 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 113271793 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 277 (W277*)
Gene Model predicted gene model for transcript(s):
Predicted Effect probably null
Transcript: ENSMUST00000137336
AA Change: W277*
SMART Domains Protein: ENSMUSP00000118012
Gene: ENSMUSG00000087642
AA Change: W277*

DomainStartEndE-ValueType
IGc1 18 85 2.5e-6 SMART
IG_like 116 190 2.3e-5 SMART
IG_like 221 295 3e-4 SMART
low complexity region 310 323 N/A INTRINSIC
IGc1 325 402 7.4e-35 SMART
Predicted Effect probably null
Transcript: ENSMUST00000223335
AA Change: W277*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,598 L136P probably benign Het
4932438H23Rik T G 16: 91,055,612 Y212S probably damaging Het
Angpt1 T C 15: 42,512,399 N154D probably damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Ankrd27 T A 7: 35,601,626 L117* probably null Het
Arhgap21 C T 2: 20,854,180 M1234I probably benign Het
Arhgef33 A G 17: 80,367,335 E387G probably damaging Het
Atp13a4 T A 16: 29,454,769 K444* probably null Het
Atp6v1a G A 16: 44,101,862 R338C probably damaging Het
Canx T C 11: 50,311,647 D44G possibly damaging Het
Ccdc141 T A 2: 77,132,244 M119L probably benign Het
Ckmt1 A C 2: 121,362,691 Q299P possibly damaging Het
Dhx16 T C 17: 35,885,920 S601P probably damaging Het
Dna2 A C 10: 62,950,894 R140S probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Eogt A G 6: 97,143,998 S85P possibly damaging Het
Fbf1 A T 11: 116,165,881 M1K probably null Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flnb G A 14: 7,950,394 V2571I probably damaging Het
Gm11361 A G 13: 28,257,711 I26V probably benign Het
Gm43518 A G 5: 123,938,259 E123G unknown Het
Gm8332 T G 12: 88,249,685 E139A unknown Het
Gpatch2 A G 1: 187,304,355 N374S probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Hoxa11 T C 6: 52,245,802 probably benign Het
Hydin G A 8: 110,582,018 V3979I probably benign Het
Kmt2c G T 5: 25,314,122 T2330K probably benign Het
Krt6a T A 15: 101,692,735 K261M probably damaging Het
Lats2 A C 14: 57,722,705 S161A probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Npepps A G 11: 97,244,426 probably null Het
Ntn4 A T 10: 93,741,104 N545Y possibly damaging Het
Olfr1501 A T 19: 13,838,402 M257K possibly damaging Het
Olfr164 T C 16: 19,286,701 D14G probably benign Het
Olfr353 A G 2: 36,890,354 S165P probably damaging Het
Olfr738 A C 14: 50,413,675 M44L probably benign Het
Osbpl2 T A 2: 180,155,343 V358E possibly damaging Het
Pdcd11 C A 19: 47,119,806 P1204Q probably damaging Het
Pnliprp2 A C 19: 58,763,374 S184R probably damaging Het
Ppm1g G T 5: 31,204,528 R373S probably damaging Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Setd5 T C 6: 113,121,087 S696P probably damaging Het
Sgip1 A G 4: 102,915,071 Q219R probably benign Het
Slc1a2 T C 2: 102,736,085 probably null Het
Slc22a12 T C 19: 6,542,437 T106A probably benign Het
Slc22a14 A G 9: 119,180,585 L148P probably damaging Het
Slc2a9 A T 5: 38,382,078 F375I probably damaging Het
Sorbs3 A T 14: 70,202,947 D117E probably benign Het
Sphkap G A 1: 83,276,500 T1176I probably damaging Het
Supt16 A T 14: 52,181,589 V193D probably damaging Het
Sytl3 A G 17: 6,728,291 T362A probably damaging Het
Tctn1 T A 5: 122,246,611 Q410L probably benign Het
Trbc2 T C 6: 41,547,777 Y133H Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r120 A G 17: 57,525,843 V112A probably benign Het
Zfp354b A T 11: 50,923,470 S209R probably benign Het
Zfp362 T C 4: 128,774,606 H391R probably damaging Het
Other mutations in Ighe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Ighe APN 12 113271515 missense unknown
IGL01315:Ighe APN 12 113271352 missense unknown
IGL01415:Ighe APN 12 113271391 missense unknown
Allegra UTSW 12 113271374 nonsense probably null
R0610:Ighe UTSW 12 113271743 missense unknown
R1540:Ighe UTSW 12 113271446 missense unknown
R1838:Ighe UTSW 12 113271850 missense unknown
R2010:Ighe UTSW 12 113271488 missense unknown
R3498:Ighe UTSW 12 113271374 nonsense probably null
R5230:Ighe UTSW 12 113271386 missense unknown
R5288:Ighe UTSW 12 113271472 missense probably benign 0.00
R6713:Ighe UTSW 12 113269288 unclassified probably benign
R7010:Ighe UTSW 12 113273141 missense
R7146:Ighe UTSW 12 113272355 missense
R7324:Ighe UTSW 12 113272334 missense
R7443:Ighe UTSW 12 113272165 nonsense probably null
R7473:Ighe UTSW 12 113271356 missense probably damaging 1.00
R7493:Ighe UTSW 12 113271403 missense
R7862:Ighe UTSW 12 113271808 missense
R7873:Ighe UTSW 12 113271322 missense
R7973:Ighe UTSW 12 113273057 missense
R8038:Ighe UTSW 12 113269433 missense
R8355:Ighe UTSW 12 113271547 nonsense probably null
R8483:Ighe UTSW 12 113272188 missense
Predicted Primers PCR Primer
(F):5'- GTTCTGGATCAAGCAGGTGAG -3'
(R):5'- TCCCAAGCTTACCTGTCTGG -3'

Sequencing Primer
(F):5'- AACACATATACCTCGGGGGCTG -3'
(R):5'- CTGGTGGTGGACCTGGAAAG -3'
Posted On2020-10-20