Mutagenetix > Incidental Mutation

Incidental Mutation 'R8508:Supt16'

655718

Institutional Source

Beutler Lab

Gene Symbol

Supt16

Ensembl Gene

ENSMUSG00000035726

Gene Name

suppressor of Ty 16

Synonyms

Supt16h, Spt16, Fact140, Cdc68

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R8508 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

52160414-52197416 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 52181589 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 193 (V193D)

Ref Sequence

ENSEMBL: ENSMUSP00000042283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046709]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000046709
AA Change: V193D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: V193D

Domain	Start	End	E-Value	Type
FACT-Spt16_Nlob	5	168	2.95e-87	SMART
Pfam:Peptidase_M24	181	411	2.9e-35	PFAM
low complexity region	435	449	N/A	INTRINSIC
coiled coil region	462	493	N/A	INTRINSIC
SPT16	529	689	3.38e-96	SMART
Rtt106	806	896	1.61e-38	SMART
low complexity region	926	946	N/A	INTRINSIC
low complexity region	951	988	N/A	INTRINSIC
coiled coil region	994	1023	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,743,598	L136P	probably benign	Het
4932438H23Rik	T	G	16: 91,055,612	Y212S	probably damaging	Het
Angpt1	T	C	15: 42,512,399	N154D	probably damaging	Het
Angpt2	G	A	8: 18,741,119	R54*	probably null	Het
Ankrd27	T	A	7: 35,601,626	L117*	probably null	Het
Arhgap21	C	T	2: 20,854,180	M1234I	probably benign	Het
Arhgef33	A	G	17: 80,367,335	E387G	probably damaging	Het
Atp13a4	T	A	16: 29,454,769	K444*	probably null	Het
Atp6v1a	G	A	16: 44,101,862	R338C	probably damaging	Het
Canx	T	C	11: 50,311,647	D44G	possibly damaging	Het
Ccdc141	T	A	2: 77,132,244	M119L	probably benign	Het
Ckmt1	A	C	2: 121,362,691	Q299P	possibly damaging	Het
Dhx16	T	C	17: 35,885,920	S601P	probably damaging	Het
Dna2	A	C	10: 62,950,894	R140S	probably damaging	Het
Dock1	A	G	7: 134,782,409	T670A	probably benign	Het
Eogt	A	G	6: 97,143,998	S85P	possibly damaging	Het
Fbf1	A	T	11: 116,165,881	M1K	probably null	Het
Fbxl12	C	A	9: 20,638,864	R165L	possibly damaging	Het
Flnb	G	A	14: 7,950,394	V2571I	probably damaging	Het
Gm11361	A	G	13: 28,257,711	I26V	probably benign	Het
Gm43518	A	G	5: 123,938,259	E123G	unknown	Het
Gm8332	T	G	12: 88,249,685	E139A	unknown	Het
Gpatch2	A	G	1: 187,304,355	N374S	probably benign	Het
Hey1	G	C	3: 8,664,776	A207G	probably benign	Het
Hoxa11	T	C	6: 52,245,802		probably benign	Het
Hydin	G	A	8: 110,582,018	V3979I	probably benign	Het
Ighe	C	T	12: 113,271,793	W277*	probably null	Het
Kmt2c	G	T	5: 25,314,122	T2330K	probably benign	Het
Krt6a	T	A	15: 101,692,735	K261M	probably damaging	Het
Lats2	A	C	14: 57,722,705	S161A	probably benign	Het
Med13l	T	A	5: 118,754,321	D1936E	probably benign	Het
Mipol1	T	C	12: 57,306,088	V71A	possibly damaging	Het
Mphosph8	A	T	14: 56,676,546	K415*	probably null	Het
Npepps	A	G	11: 97,244,426		probably null	Het
Ntn4	A	T	10: 93,741,104	N545Y	possibly damaging	Het
Olfr1501	A	T	19: 13,838,402	M257K	possibly damaging	Het
Olfr164	T	C	16: 19,286,701	D14G	probably benign	Het
Olfr353	A	G	2: 36,890,354	S165P	probably damaging	Het
Olfr738	A	C	14: 50,413,675	M44L	probably benign	Het
Osbpl2	T	A	2: 180,155,343	V358E	possibly damaging	Het
Pdcd11	C	A	19: 47,119,806	P1204Q	probably damaging	Het
Pnliprp2	A	C	19: 58,763,374	S184R	probably damaging	Het
Ppm1g	G	T	5: 31,204,528	R373S	probably damaging	Het
Rnf130	A	G	11: 50,087,437	D275G	probably damaging	Het
Setd5	T	C	6: 113,121,087	S696P	probably damaging	Het
Sgip1	A	G	4: 102,915,071	Q219R	probably benign	Het
Slc1a2	T	C	2: 102,736,085		probably null	Het
Slc22a12	T	C	19: 6,542,437	T106A	probably benign	Het
Slc22a14	A	G	9: 119,180,585	L148P	probably damaging	Het
Slc2a9	A	T	5: 38,382,078	F375I	probably damaging	Het
Sorbs3	A	T	14: 70,202,947	D117E	probably benign	Het
Sphkap	G	A	1: 83,276,500	T1176I	probably damaging	Het
Sytl3	A	G	17: 6,728,291	T362A	probably damaging	Het
Tctn1	T	A	5: 122,246,611	Q410L	probably benign	Het
Trbc2	T	C	6: 41,547,777	Y133H		Het
Ttc28	G	A	5: 111,233,341	D1240N	probably benign	Het
Vmn2r120	A	G	17: 57,525,843	V112A	probably benign	Het
Zfp354b	A	T	11: 50,923,470	S209R	probably benign	Het
Zfp362	T	C	4: 128,774,606	H391R	probably damaging	Het

Other mutations in Supt16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Supt16	APN	14	52161798	missense	possibly damaging	0.72
IGL00985:Supt16	APN	14	52161691	missense	possibly damaging	0.53
IGL01160:Supt16	APN	14	52183132	missense	probably benign
IGL01328:Supt16	APN	14	52177032	missense	probably benign	0.20
IGL01329:Supt16	APN	14	52177032	missense	probably benign	0.20
IGL01413:Supt16	APN	14	52177032	missense	probably benign	0.20
IGL01414:Supt16	APN	14	52177032	missense	probably benign	0.20
IGL01535:Supt16	APN	14	52177190	missense	probably damaging	0.99
IGL01765:Supt16	APN	14	52180223	missense	probably damaging	0.98
IGL01976:Supt16	APN	14	52182307	missense	possibly damaging	0.70
IGL02422:Supt16	APN	14	52179543	missense	possibly damaging	0.85
IGL02449:Supt16	APN	14	52173806	missense	possibly damaging	0.92
IGL02516:Supt16	APN	14	52183964	missense	possibly damaging	0.57
IGL02831:Supt16	APN	14	52170878	missense	possibly damaging	0.70
IGL03112:Supt16	APN	14	52176398	missense	probably damaging	0.98
IGL03406:Supt16	APN	14	52178141	missense	possibly damaging	0.92
R7336_Supt16_529	UTSW	14	52171491	missense	possibly damaging	0.93
watercolor	UTSW	14	52170881	missense	probably damaging	0.96
R0332:Supt16	UTSW	14	52181157	missense	probably damaging	0.99
R0385:Supt16	UTSW	14	52176718	missense	probably benign	0.01
R0389:Supt16	UTSW	14	52174113	missense	probably damaging	0.98
R0422:Supt16	UTSW	14	52183996	missense	probably benign	0.26
R1101:Supt16	UTSW	14	52171439	missense	probably null	0.81
R1212:Supt16	UTSW	14	52174124	nonsense	probably null
R1487:Supt16	UTSW	14	52176608	critical splice donor site	probably null
R1494:Supt16	UTSW	14	52172459	missense	probably benign	0.01
R1566:Supt16	UTSW	14	52176655	missense	probably damaging	0.99
R1652:Supt16	UTSW	14	52177180	missense	probably benign	0.34
R1913:Supt16	UTSW	14	52178135	missense	possibly damaging	0.84
R2220:Supt16	UTSW	14	52172144	nonsense	probably null
R2344:Supt16	UTSW	14	52178118	missense	probably benign	0.00
R3430:Supt16	UTSW	14	52175359	missense	probably benign	0.05
R3746:Supt16	UTSW	14	52180139	missense	probably damaging	0.99
R3749:Supt16	UTSW	14	52180139	missense	probably damaging	0.99
R4010:Supt16	UTSW	14	52164441	missense	probably damaging	1.00
R4108:Supt16	UTSW	14	52162731	missense	probably damaging	1.00
R4109:Supt16	UTSW	14	52162731	missense	probably damaging	1.00
R4597:Supt16	UTSW	14	52173589	missense	probably damaging	1.00
R5117:Supt16	UTSW	14	52183092	missense	probably damaging	1.00
R5309:Supt16	UTSW	14	52162698	missense	probably damaging	1.00
R5695:Supt16	UTSW	14	52174144	splice site	probably null
R5895:Supt16	UTSW	14	52164522	missense	probably benign	0.17
R5941:Supt16	UTSW	14	52182196	missense	probably benign
R5993:Supt16	UTSW	14	52178334	missense	probably damaging	1.00
R6197:Supt16	UTSW	14	52170881	missense	probably damaging	0.96
R6254:Supt16	UTSW	14	52170834	missense	probably damaging	1.00
R6381:Supt16	UTSW	14	52179546	missense	probably benign	0.02
R6667:Supt16	UTSW	14	52172063	missense	probably damaging	1.00
R7000:Supt16	UTSW	14	52171450	missense	probably damaging	0.97
R7063:Supt16	UTSW	14	52172048	missense	possibly damaging	0.92
R7276:Supt16	UTSW	14	52177001	missense	probably benign
R7336:Supt16	UTSW	14	52171491	missense	possibly damaging	0.93
R7344:Supt16	UTSW	14	52173571	missense	probably damaging	0.98
R7384:Supt16	UTSW	14	52181162	missense	probably damaging	0.99
R7411:Supt16	UTSW	14	52178051	missense	probably damaging	1.00
R7586:Supt16	UTSW	14	52173556	missense	probably damaging	0.97
R7633:Supt16	UTSW	14	52197099	missense	probably benign	0.38
R8024:Supt16	UTSW	14	52170875	missense	probably damaging	0.96
R8197:Supt16	UTSW	14	52174085	missense	possibly damaging	0.95
R8201:Supt16	UTSW	14	52170990	missense	probably damaging	1.00
R8285:Supt16	UTSW	14	52181083	missense	possibly damaging	0.95
R8531:Supt16	UTSW	14	52172563	missense	probably damaging	0.98
R8797:Supt16	UTSW	14	52172503	missense	probably damaging	0.99
R8872:Supt16	UTSW	14	52174087	missense	probably benign	0.01
R9048:Supt16	UTSW	14	52181056	missense	probably damaging	1.00
Z1177:Supt16	UTSW	14	52163285	missense	possibly damaging	0.63
Z1177:Supt16	UTSW	14	52181537	missense	probably null	0.21

Predicted Primers

PCR Primer
(F):5'- GGAGATGGCAGTTACCAACTTC -3'
(R):5'- CACATGTTCTGAGAGAGGTGC -3'

Sequencing Primer
(F):5'- TGGCAGTTACCAACTTCAAAGG -3'
(R):5'- AGAGGTGCTCTAAGTGTAGACTC -3'

Posted On

2020-10-20