Incidental Mutation 'R8508:Supt16'
ID655718
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Namesuppressor of Ty 16
SynonymsSupt16h, Spt16, Fact140, Cdc68
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R8508 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location52160414-52197416 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52181589 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 193 (V193D)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
Predicted Effect probably damaging
Transcript: ENSMUST00000046709
AA Change: V193D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: V193D

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,598 L136P probably benign Het
4932438H23Rik T G 16: 91,055,612 Y212S probably damaging Het
Angpt1 T C 15: 42,512,399 N154D probably damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Ankrd27 T A 7: 35,601,626 L117* probably null Het
Arhgap21 C T 2: 20,854,180 M1234I probably benign Het
Arhgef33 A G 17: 80,367,335 E387G probably damaging Het
Atp13a4 T A 16: 29,454,769 K444* probably null Het
Atp6v1a G A 16: 44,101,862 R338C probably damaging Het
Canx T C 11: 50,311,647 D44G possibly damaging Het
Ccdc141 T A 2: 77,132,244 M119L probably benign Het
Ckmt1 A C 2: 121,362,691 Q299P possibly damaging Het
Dhx16 T C 17: 35,885,920 S601P probably damaging Het
Dna2 A C 10: 62,950,894 R140S probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Eogt A G 6: 97,143,998 S85P possibly damaging Het
Fbf1 A T 11: 116,165,881 M1K probably null Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flnb G A 14: 7,950,394 V2571I probably damaging Het
Gm11361 A G 13: 28,257,711 I26V probably benign Het
Gm43518 A G 5: 123,938,259 E123G unknown Het
Gm8332 T G 12: 88,249,685 E139A unknown Het
Gpatch2 A G 1: 187,304,355 N374S probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Hoxa11 T C 6: 52,245,802 probably benign Het
Hydin G A 8: 110,582,018 V3979I probably benign Het
Ighe C T 12: 113,271,793 W277* probably null Het
Kmt2c G T 5: 25,314,122 T2330K probably benign Het
Krt6a T A 15: 101,692,735 K261M probably damaging Het
Lats2 A C 14: 57,722,705 S161A probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Npepps A G 11: 97,244,426 probably null Het
Ntn4 A T 10: 93,741,104 N545Y possibly damaging Het
Olfr1501 A T 19: 13,838,402 M257K possibly damaging Het
Olfr164 T C 16: 19,286,701 D14G probably benign Het
Olfr353 A G 2: 36,890,354 S165P probably damaging Het
Olfr738 A C 14: 50,413,675 M44L probably benign Het
Osbpl2 T A 2: 180,155,343 V358E possibly damaging Het
Pdcd11 C A 19: 47,119,806 P1204Q probably damaging Het
Pnliprp2 A C 19: 58,763,374 S184R probably damaging Het
Ppm1g G T 5: 31,204,528 R373S probably damaging Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Setd5 T C 6: 113,121,087 S696P probably damaging Het
Sgip1 A G 4: 102,915,071 Q219R probably benign Het
Slc1a2 T C 2: 102,736,085 probably null Het
Slc22a12 T C 19: 6,542,437 T106A probably benign Het
Slc22a14 A G 9: 119,180,585 L148P probably damaging Het
Slc2a9 A T 5: 38,382,078 F375I probably damaging Het
Sorbs3 A T 14: 70,202,947 D117E probably benign Het
Sphkap G A 1: 83,276,500 T1176I probably damaging Het
Sytl3 A G 17: 6,728,291 T362A probably damaging Het
Tctn1 T A 5: 122,246,611 Q410L probably benign Het
Trbc2 T C 6: 41,547,777 Y133H Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r120 A G 17: 57,525,843 V112A probably benign Het
Zfp354b A T 11: 50,923,470 S209R probably benign Het
Zfp362 T C 4: 128,774,606 H391R probably damaging Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52161798 missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52161691 missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52183132 missense probably benign
IGL01328:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01329:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01413:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01414:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01535:Supt16 APN 14 52177190 missense probably damaging 0.99
IGL01765:Supt16 APN 14 52180223 missense probably damaging 0.98
IGL01976:Supt16 APN 14 52182307 missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52179543 missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52173806 missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52183964 missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52170878 missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52176398 missense probably damaging 0.98
IGL03406:Supt16 APN 14 52178141 missense possibly damaging 0.92
watercolor UTSW 14 52170881 missense probably damaging 0.96
R0332:Supt16 UTSW 14 52181157 missense probably damaging 0.99
R0385:Supt16 UTSW 14 52176718 missense probably benign 0.01
R0389:Supt16 UTSW 14 52174113 missense probably damaging 0.98
R0422:Supt16 UTSW 14 52183996 missense probably benign 0.26
R1101:Supt16 UTSW 14 52171439 missense probably null 0.81
R1212:Supt16 UTSW 14 52174124 nonsense probably null
R1487:Supt16 UTSW 14 52176608 critical splice donor site probably null
R1494:Supt16 UTSW 14 52172459 missense probably benign 0.01
R1566:Supt16 UTSW 14 52176655 missense probably damaging 0.99
R1652:Supt16 UTSW 14 52177180 missense probably benign 0.34
R1913:Supt16 UTSW 14 52178135 missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52172144 nonsense probably null
R2344:Supt16 UTSW 14 52178118 missense probably benign 0.00
R3430:Supt16 UTSW 14 52175359 missense probably benign 0.05
R3746:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R3749:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R4010:Supt16 UTSW 14 52164441 missense probably damaging 1.00
R4108:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4109:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4597:Supt16 UTSW 14 52173589 missense probably damaging 1.00
R5117:Supt16 UTSW 14 52183092 missense probably damaging 1.00
R5309:Supt16 UTSW 14 52162698 missense probably damaging 1.00
R5695:Supt16 UTSW 14 52174144 splice site probably null
R5895:Supt16 UTSW 14 52164522 missense probably benign 0.17
R5941:Supt16 UTSW 14 52182196 missense probably benign
R5993:Supt16 UTSW 14 52178334 missense probably damaging 1.00
R6197:Supt16 UTSW 14 52170881 missense probably damaging 0.96
R6254:Supt16 UTSW 14 52170834 missense probably damaging 1.00
R6381:Supt16 UTSW 14 52179546 missense probably benign 0.02
R6667:Supt16 UTSW 14 52172063 missense probably damaging 1.00
R7000:Supt16 UTSW 14 52171450 missense probably damaging 0.97
R7063:Supt16 UTSW 14 52172048 missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52177001 missense probably benign
R7336:Supt16 UTSW 14 52171491 missense possibly damaging 0.93
R7344:Supt16 UTSW 14 52173571 missense probably damaging 0.98
R7384:Supt16 UTSW 14 52181162 missense probably damaging 0.99
R7411:Supt16 UTSW 14 52178051 missense probably damaging 1.00
R7586:Supt16 UTSW 14 52173556 missense probably damaging 0.97
R7633:Supt16 UTSW 14 52197099 missense probably benign 0.38
R8024:Supt16 UTSW 14 52170875 missense probably damaging 0.96
R8197:Supt16 UTSW 14 52174085 missense possibly damaging 0.95
R8201:Supt16 UTSW 14 52170990 missense probably damaging 1.00
R8285:Supt16 UTSW 14 52181083 missense possibly damaging 0.95
R8531:Supt16 UTSW 14 52172563 missense probably damaging 0.98
Z1177:Supt16 UTSW 14 52163285 missense possibly damaging 0.63
Z1177:Supt16 UTSW 14 52181537 missense probably null 0.21
Predicted Primers PCR Primer
(F):5'- GGAGATGGCAGTTACCAACTTC -3'
(R):5'- CACATGTTCTGAGAGAGGTGC -3'

Sequencing Primer
(F):5'- TGGCAGTTACCAACTTCAAAGG -3'
(R):5'- AGAGGTGCTCTAAGTGTAGACTC -3'
Posted On2020-10-20