Mutagenetix > Incidental Mutations

Incidental Mutation 'R8508:Sorbs3'

655721

Institutional Source

Beutler Lab

Gene Symbol

Sorbs3

Ensembl Gene

ENSMUSG00000022091

Gene Name

sorbin and SH3 domain containing 3

Synonyms

SH3P3, Sh3d4, vinexin beta, vinexin alpha

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8508 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70180468-70211989 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70202947 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 117 (D117E)

Ref Sequence

ENSEMBL: ENSMUSP00000022682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022682] [ENSMUST00000227259] [ENSMUST00000227653] [ENSMUST00000227929]

Predicted Effect

probably benign
Transcript: ENSMUST00000022682
AA Change: D117E

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000022682
Gene: ENSMUSG00000022091
AA Change: D117E

Domain	Start	End	E-Value	Type
Sorb	165	214	6.87e-30	SMART
SH3	447	502	9.24e-21	SMART
SH3	521	578	4.18e-19	SMART
low complexity region	597	613	N/A	INTRINSIC
SH3	677	733	8.31e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227259
AA Change: D64E

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

probably benign
Transcript: ENSMUST00000227653
AA Change: D64E

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

Predicted Effect

probably benign
Transcript: ENSMUST00000227929
AA Change: D117E

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an SH3 domain-containing adaptor protein. The presence of SH3 domains play a role in this protein's ability to bind other cytoplasmic molecules and contribute to cystoskeletal organization, cell adhesion and migration, signaling, and gene expression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutants are generally normal, viable, and fertile, except showing delayed wound healing in response to full-thickness skin injury in vivo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	G	13: 59,743,598	L136P	probably benign	Het
4932438H23Rik	T	G	16: 91,055,612	Y212S	probably damaging	Het
Angpt1	T	C	15: 42,512,399	N154D	probably damaging	Het
Angpt2	G	A	8: 18,741,119	R54*	probably null	Het
Ankrd27	T	A	7: 35,601,626	L117*	probably null	Het
Arhgap21	C	T	2: 20,854,180	M1234I	probably benign	Het
Arhgef33	A	G	17: 80,367,335	E387G	probably damaging	Het
Atp13a4	T	A	16: 29,454,769	K444*	probably null	Het
Atp6v1a	G	A	16: 44,101,862	R338C	probably damaging	Het
Canx	T	C	11: 50,311,647	D44G	possibly damaging	Het
Ccdc141	T	A	2: 77,132,244	M119L	probably benign	Het
Ckmt1	A	C	2: 121,362,691	Q299P	possibly damaging	Het
Dhx16	T	C	17: 35,885,920	S601P	probably damaging	Het
Dna2	A	C	10: 62,950,894	R140S	probably damaging	Het
Dock1	A	G	7: 134,782,409	T670A	probably benign	Het
Eogt	A	G	6: 97,143,998	S85P	possibly damaging	Het
Fbf1	A	T	11: 116,165,881	M1K	probably null	Het
Fbxl12	C	A	9: 20,638,864	R165L	possibly damaging	Het
Flnb	G	A	14: 7,950,394	V2571I	probably damaging	Het
Gm11361	A	G	13: 28,257,711	I26V	probably benign	Het
Gm43518	A	G	5: 123,938,259	E123G	unknown	Het
Gm8332	T	G	12: 88,249,685	E139A	unknown	Het
Gpatch2	A	G	1: 187,304,355	N374S	probably benign	Het
Hey1	G	C	3: 8,664,776	A207G	probably benign	Het
Hoxa11	T	C	6: 52,245,802		probably benign	Het
Hydin	G	A	8: 110,582,018	V3979I	probably benign	Het
Ighe	C	T	12: 113,271,793	W277*	probably null	Het
Kmt2c	G	T	5: 25,314,122	T2330K	probably benign	Het
Krt6a	T	A	15: 101,692,735	K261M	probably damaging	Het
Lats2	A	C	14: 57,722,705	S161A	probably benign	Het
Med13l	T	A	5: 118,754,321	D1936E	probably benign	Het
Mipol1	T	C	12: 57,306,088	V71A	possibly damaging	Het
Mphosph8	A	T	14: 56,676,546	K415*	probably null	Het
Npepps	A	G	11: 97,244,426		probably null	Het
Ntn4	A	T	10: 93,741,104	N545Y	possibly damaging	Het
Olfr1501	A	T	19: 13,838,402	M257K	possibly damaging	Het
Olfr164	T	C	16: 19,286,701	D14G	probably benign	Het
Olfr353	A	G	2: 36,890,354	S165P	probably damaging	Het
Olfr738	A	C	14: 50,413,675	M44L	probably benign	Het
Osbpl2	T	A	2: 180,155,343	V358E	possibly damaging	Het
Pdcd11	C	A	19: 47,119,806	P1204Q	probably damaging	Het
Pnliprp2	A	C	19: 58,763,374	S184R	probably damaging	Het
Ppm1g	G	T	5: 31,204,528	R373S	probably damaging	Het
Rnf130	A	G	11: 50,087,437	D275G	probably damaging	Het
Setd5	T	C	6: 113,121,087	S696P	probably damaging	Het
Sgip1	A	G	4: 102,915,071	Q219R	probably benign	Het
Slc1a2	T	C	2: 102,736,085		probably null	Het
Slc22a12	T	C	19: 6,542,437	T106A	probably benign	Het
Slc22a14	A	G	9: 119,180,585	L148P	probably damaging	Het
Slc2a9	A	T	5: 38,382,078	F375I	probably damaging	Het
Sphkap	G	A	1: 83,276,500	T1176I	probably damaging	Het
Supt16	A	T	14: 52,181,589	V193D	probably damaging	Het
Sytl3	A	G	17: 6,728,291	T362A	probably damaging	Het
Tctn1	T	A	5: 122,246,611	Q410L	probably benign	Het
Trbc2	T	C	6: 41,547,777	Y133H		Het
Ttc28	G	A	5: 111,233,341	D1240N	probably benign	Het
Vmn2r120	A	G	17: 57,525,843	V112A	probably benign	Het
Zfp354b	A	T	11: 50,923,470	S209R	probably benign	Het
Zfp362	T	C	4: 128,774,606	H391R	probably damaging	Het

Other mutations in Sorbs3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01069:Sorbs3	APN	14	70191155	missense	probably damaging	1.00
IGL01144:Sorbs3	APN	14	70191568	missense	probably benign	0.04
IGL01155:Sorbs3	APN	14	70199341	missense	probably damaging	1.00
IGL01465:Sorbs3	APN	14	70195509	splice site	probably benign
IGL02184:Sorbs3	APN	14	70184006	critical splice donor site	probably null
R0544:Sorbs3	UTSW	14	70193926	missense	probably benign	0.01
R0882:Sorbs3	UTSW	14	70207572	missense	probably damaging	1.00
R1445:Sorbs3	UTSW	14	70193646	missense	probably benign	0.12
R1493:Sorbs3	UTSW	14	70192627	missense	possibly damaging	0.71
R1505:Sorbs3	UTSW	14	70190802	nonsense	probably null
R1671:Sorbs3	UTSW	14	70191466	missense	possibly damaging	0.92
R2184:Sorbs3	UTSW	14	70191431	critical splice donor site	probably null
R3804:Sorbs3	UTSW	14	70199351	splice site	probably benign
R4527:Sorbs3	UTSW	14	70207617	missense	probably damaging	1.00
R4755:Sorbs3	UTSW	14	70184099	missense	probably benign	0.00
R4926:Sorbs3	UTSW	14	70186945	missense	probably damaging	1.00
R5257:Sorbs3	UTSW	14	70185034	missense	probably benign	0.00
R5304:Sorbs3	UTSW	14	70184896	nonsense	probably null
R5328:Sorbs3	UTSW	14	70181174	missense	probably damaging	1.00
R5684:Sorbs3	UTSW	14	70181222	missense	probably damaging	1.00
R5988:Sorbs3	UTSW	14	70203303	missense	probably benign	0.03
R6106:Sorbs3	UTSW	14	70192604	splice site	probably null
R7207:Sorbs3	UTSW	14	70201485	missense	probably damaging	1.00
R7562:Sorbs3	UTSW	14	70207527	missense	probably benign	0.00
R7831:Sorbs3	UTSW	14	70203032	missense	possibly damaging	0.93
R7893:Sorbs3	UTSW	14	70193916	missense	probably benign	0.35
R8393:Sorbs3	UTSW	14	70184911	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- TCCTTTCTCAAGATCTGCAGG -3'
(R):5'- GACAGTCTGAAGGAAGCTCC -3'

Sequencing Primer
(F):5'- GGATCACAGAGAACCCTAAGCTG -3'
(R):5'- TCCGAAACTTCCCCAGGAGG -3'

Posted On

2020-10-20