Incidental Mutation 'R8508:Angpt1'
ID655722
Institutional Source Beutler Lab
Gene Symbol Angpt1
Ensembl Gene ENSMUSG00000022309
Gene Nameangiopoietin 1
SynonymsAngiopoietin-1, 1110046O21Rik, Ang-1, ang1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8508 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location42424723-42676977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42512399 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 154 (N154D)
Ref Sequence ENSEMBL: ENSMUSP00000022921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022921]
Predicted Effect probably damaging
Transcript: ENSMUST00000022921
AA Change: N154D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022921
Gene: ENSMUSG00000022309
AA Change: N154D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 194 254 N/A INTRINSIC
FBG 281 496 3.04e-132 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted glycoprotein that belongs to the angiopoietin family of vascular growth factors. The encoded protein is a ligand in the vascular tyrosine kinase signaling pathway and regulates the formation and stabilization of blood vessels. This protein also functions in striated muscles by promoting proliferation, migration and differentiation of skeletal myoblasts and plays an essential role in the vascular response to tissue injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality by E12.5 and deficits in vascular development such as a reduction in vascular branching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,598 L136P probably benign Het
4932438H23Rik T G 16: 91,055,612 Y212S probably damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Ankrd27 T A 7: 35,601,626 L117* probably null Het
Arhgap21 C T 2: 20,854,180 M1234I probably benign Het
Arhgef33 A G 17: 80,367,335 E387G probably damaging Het
Atp13a4 T A 16: 29,454,769 K444* probably null Het
Atp6v1a G A 16: 44,101,862 R338C probably damaging Het
Canx T C 11: 50,311,647 D44G possibly damaging Het
Ccdc141 T A 2: 77,132,244 M119L probably benign Het
Ckmt1 A C 2: 121,362,691 Q299P possibly damaging Het
Dhx16 T C 17: 35,885,920 S601P probably damaging Het
Dna2 A C 10: 62,950,894 R140S probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Eogt A G 6: 97,143,998 S85P possibly damaging Het
Fbf1 A T 11: 116,165,881 M1K probably null Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flnb G A 14: 7,950,394 V2571I probably damaging Het
Gm11361 A G 13: 28,257,711 I26V probably benign Het
Gm43518 A G 5: 123,938,259 E123G unknown Het
Gm8332 T G 12: 88,249,685 E139A unknown Het
Gpatch2 A G 1: 187,304,355 N374S probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Hoxa11 T C 6: 52,245,802 probably benign Het
Hydin G A 8: 110,582,018 V3979I probably benign Het
Ighe C T 12: 113,271,793 W277* probably null Het
Kmt2c G T 5: 25,314,122 T2330K probably benign Het
Krt6a T A 15: 101,692,735 K261M probably damaging Het
Lats2 A C 14: 57,722,705 S161A probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Npepps A G 11: 97,244,426 probably null Het
Ntn4 A T 10: 93,741,104 N545Y possibly damaging Het
Olfr1501 A T 19: 13,838,402 M257K possibly damaging Het
Olfr164 T C 16: 19,286,701 D14G probably benign Het
Olfr353 A G 2: 36,890,354 S165P probably damaging Het
Olfr738 A C 14: 50,413,675 M44L probably benign Het
Osbpl2 T A 2: 180,155,343 V358E possibly damaging Het
Pdcd11 C A 19: 47,119,806 P1204Q probably damaging Het
Pnliprp2 A C 19: 58,763,374 S184R probably damaging Het
Ppm1g G T 5: 31,204,528 R373S probably damaging Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Setd5 T C 6: 113,121,087 S696P probably damaging Het
Sgip1 A G 4: 102,915,071 Q219R probably benign Het
Slc1a2 T C 2: 102,736,085 probably null Het
Slc22a12 T C 19: 6,542,437 T106A probably benign Het
Slc22a14 A G 9: 119,180,585 L148P probably damaging Het
Slc2a9 A T 5: 38,382,078 F375I probably damaging Het
Sorbs3 A T 14: 70,202,947 D117E probably benign Het
Sphkap G A 1: 83,276,500 T1176I probably damaging Het
Supt16 A T 14: 52,181,589 V193D probably damaging Het
Sytl3 A G 17: 6,728,291 T362A probably damaging Het
Tctn1 T A 5: 122,246,611 Q410L probably benign Het
Trbc2 T C 6: 41,547,777 Y133H Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r120 A G 17: 57,525,843 V112A probably benign Het
Zfp354b A T 11: 50,923,470 S209R probably benign Het
Zfp362 T C 4: 128,774,606 H391R probably damaging Het
Other mutations in Angpt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Angpt1 APN 15 42476467 missense possibly damaging 0.73
IGL02671:Angpt1 APN 15 42676394 missense possibly damaging 0.79
IGL02876:Angpt1 APN 15 42426977 missense possibly damaging 0.68
IGL03077:Angpt1 APN 15 42476422 nonsense probably null
IGL03334:Angpt1 APN 15 42496412 missense possibly damaging 0.94
R0226:Angpt1 UTSW 15 42468235 missense probably benign 0.01
R1774:Angpt1 UTSW 15 42523616 missense probably damaging 0.99
R1800:Angpt1 UTSW 15 42512404 missense probably damaging 0.96
R1967:Angpt1 UTSW 15 42438307 missense probably damaging 1.00
R4093:Angpt1 UTSW 15 42523545 missense probably damaging 1.00
R4477:Angpt1 UTSW 15 42468164 missense probably damaging 1.00
R4629:Angpt1 UTSW 15 42438400 missense probably benign 0.01
R4647:Angpt1 UTSW 15 42676184 missense probably benign 0.02
R4648:Angpt1 UTSW 15 42676184 missense probably benign 0.02
R4750:Angpt1 UTSW 15 42676401 missense probably benign 0.00
R5222:Angpt1 UTSW 15 42676334 missense probably damaging 1.00
R5386:Angpt1 UTSW 15 42438365 missense probably damaging 1.00
R5457:Angpt1 UTSW 15 42523520 missense probably damaging 1.00
R5526:Angpt1 UTSW 15 42512341 missense probably damaging 1.00
R6154:Angpt1 UTSW 15 42523655 missense probably damaging 1.00
R6904:Angpt1 UTSW 15 42459740 missense probably benign 0.00
R7009:Angpt1 UTSW 15 42523595 missense possibly damaging 0.83
R7101:Angpt1 UTSW 15 42523569 missense probably benign 0.18
R7139:Angpt1 UTSW 15 42676351 missense probably damaging 1.00
R7234:Angpt1 UTSW 15 42459725 missense probably benign 0.25
R7830:Angpt1 UTSW 15 42676268 missense probably damaging 1.00
R8046:Angpt1 UTSW 15 42496356 missense probably benign 0.00
R8073:Angpt1 UTSW 15 42438303 missense probably benign 0.00
R8093:Angpt1 UTSW 15 42476477 missense probably benign 0.01
R8331:Angpt1 UTSW 15 42676257 missense probably damaging 1.00
R8391:Angpt1 UTSW 15 42512398 missense probably damaging 1.00
R8411:Angpt1 UTSW 15 42427034 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATTGGCTGTACCTGCATC -3'
(R):5'- AAACTTAGTTCCCATCTGCCTG -3'

Sequencing Primer
(F):5'- AAGAAACTTTCAGTTGCCGGTG -3'
(R):5'- GCCTGTGTTTCCACTTACAAAG -3'
Posted On2020-10-20