Incidental Mutation 'R8508:Angpt1'
ID 655722
Institutional Source Beutler Lab
Gene Symbol Angpt1
Ensembl Gene ENSMUSG00000022309
Gene Name angiopoietin 1
Synonyms Angiopoietin-1, 1110046O21Rik, Ang-1, ang1
MMRRC Submission 067844-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8508 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 42288119-42540373 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42375795 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 154 (N154D)
Ref Sequence ENSEMBL: ENSMUSP00000022921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022921]
AlphaFold O08538
Predicted Effect probably damaging
Transcript: ENSMUST00000022921
AA Change: N154D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022921
Gene: ENSMUSG00000022309
AA Change: N154D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 194 254 N/A INTRINSIC
FBG 281 496 3.04e-132 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted glycoprotein that belongs to the angiopoietin family of vascular growth factors. The encoded protein is a ligand in the vascular tyrosine kinase signaling pathway and regulates the formation and stabilization of blood vessels. This protein also functions in striated muscles by promoting proliferation, migration and differentiation of skeletal myoblasts and plays an essential role in the vascular response to tissue injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality by E12.5 and deficits in vascular development such as a reduction in vascular branching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T G 16: 90,852,500 (GRCm39) Y212S probably damaging Het
Angpt2 G A 8: 18,791,135 (GRCm39) R54* probably null Het
Ankrd27 T A 7: 35,301,051 (GRCm39) L117* probably null Het
Arhgap21 C T 2: 20,858,991 (GRCm39) M1234I probably benign Het
Arhgef33 A G 17: 80,674,764 (GRCm39) E387G probably damaging Het
Atp13a4 T A 16: 29,273,587 (GRCm39) K444* probably null Het
Atp6v1a G A 16: 43,922,225 (GRCm39) R338C probably damaging Het
Canx T C 11: 50,202,474 (GRCm39) D44G possibly damaging Het
Ccdc141 T A 2: 76,962,588 (GRCm39) M119L probably benign Het
Ckmt1 A C 2: 121,193,172 (GRCm39) Q299P possibly damaging Het
Dhx16 T C 17: 36,196,812 (GRCm39) S601P probably damaging Het
Dna2 A C 10: 62,786,673 (GRCm39) R140S probably damaging Het
Dock1 A G 7: 134,384,138 (GRCm39) T670A probably benign Het
Eif1ad10 T G 12: 88,216,455 (GRCm39) E139A unknown Het
Eogt A G 6: 97,120,959 (GRCm39) S85P possibly damaging Het
Fbf1 A T 11: 116,056,707 (GRCm39) M1K probably null Het
Fbxl12 C A 9: 20,550,160 (GRCm39) R165L possibly damaging Het
Flnb G A 14: 7,950,394 (GRCm38) V2571I probably damaging Het
Gm43518 A G 5: 124,076,322 (GRCm39) E123G unknown Het
Gpatch2 A G 1: 187,036,552 (GRCm39) N374S probably benign Het
Hey1 G C 3: 8,729,836 (GRCm39) A207G probably benign Het
Hoxa11 T C 6: 52,222,782 (GRCm39) probably benign Het
Hydin G A 8: 111,308,650 (GRCm39) V3979I probably benign Het
Ighe C T 12: 113,235,413 (GRCm39) W277* probably null Het
Kmt2c G T 5: 25,519,120 (GRCm39) T2330K probably benign Het
Krt6a T A 15: 101,601,170 (GRCm39) K261M probably damaging Het
Lats2 A C 14: 57,960,162 (GRCm39) S161A probably benign Het
Med13l T A 5: 118,892,386 (GRCm39) D1936E probably benign Het
Mipol1 T C 12: 57,352,874 (GRCm39) V71A possibly damaging Het
Mphosph8 A T 14: 56,914,003 (GRCm39) K415* probably null Het
Npepps A G 11: 97,135,252 (GRCm39) probably null Het
Ntn4 A T 10: 93,576,966 (GRCm39) N545Y possibly damaging Het
Or11g1 A C 14: 50,651,132 (GRCm39) M44L probably benign Het
Or1n1b A G 2: 36,780,366 (GRCm39) S165P probably damaging Het
Or2m12 T C 16: 19,105,451 (GRCm39) D14G probably benign Het
Or9i2 A T 19: 13,815,766 (GRCm39) M257K possibly damaging Het
Osbpl2 T A 2: 179,797,136 (GRCm39) V358E possibly damaging Het
Pdcd11 C A 19: 47,108,245 (GRCm39) P1204Q probably damaging Het
Pnliprp2 A C 19: 58,751,806 (GRCm39) S184R probably damaging Het
Ppm1g G T 5: 31,361,872 (GRCm39) R373S probably damaging Het
Rnf130 A G 11: 49,978,264 (GRCm39) D275G probably damaging Het
Rps18-ps5 A G 13: 28,441,694 (GRCm39) I26V probably benign Het
Setd5 T C 6: 113,098,048 (GRCm39) S696P probably damaging Het
Sgip1 A G 4: 102,772,268 (GRCm39) Q219R probably benign Het
Slc1a2 T C 2: 102,566,430 (GRCm39) probably null Het
Slc22a12 T C 19: 6,592,467 (GRCm39) T106A probably benign Het
Slc22a14 A G 9: 119,009,651 (GRCm39) L148P probably damaging Het
Slc2a9 A T 5: 38,539,421 (GRCm39) F375I probably damaging Het
Sorbs3 A T 14: 70,440,396 (GRCm39) D117E probably benign Het
Spata31d1e A G 13: 59,891,412 (GRCm39) L136P probably benign Het
Sphkap G A 1: 83,254,221 (GRCm39) T1176I probably damaging Het
Supt16 A T 14: 52,419,046 (GRCm39) V193D probably damaging Het
Sytl3 A G 17: 6,995,690 (GRCm39) T362A probably damaging Het
Tctn1 T A 5: 122,384,674 (GRCm39) Q410L probably benign Het
Trbc2 T C 6: 41,524,711 (GRCm39) Y133H Het
Ttc28 G A 5: 111,381,207 (GRCm39) D1240N probably benign Het
Vmn2r120 A G 17: 57,832,843 (GRCm39) V112A probably benign Het
Zfp354b A T 11: 50,814,297 (GRCm39) S209R probably benign Het
Zfp362 T C 4: 128,668,399 (GRCm39) H391R probably damaging Het
Other mutations in Angpt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Angpt1 APN 15 42,339,863 (GRCm39) missense possibly damaging 0.73
IGL02671:Angpt1 APN 15 42,539,790 (GRCm39) missense possibly damaging 0.79
IGL02876:Angpt1 APN 15 42,290,373 (GRCm39) missense possibly damaging 0.68
IGL03077:Angpt1 APN 15 42,339,818 (GRCm39) nonsense probably null
IGL03334:Angpt1 APN 15 42,359,808 (GRCm39) missense possibly damaging 0.94
R0226:Angpt1 UTSW 15 42,331,631 (GRCm39) missense probably benign 0.01
R1774:Angpt1 UTSW 15 42,387,012 (GRCm39) missense probably damaging 0.99
R1800:Angpt1 UTSW 15 42,375,800 (GRCm39) missense probably damaging 0.96
R1967:Angpt1 UTSW 15 42,301,703 (GRCm39) missense probably damaging 1.00
R4093:Angpt1 UTSW 15 42,386,941 (GRCm39) missense probably damaging 1.00
R4477:Angpt1 UTSW 15 42,331,560 (GRCm39) missense probably damaging 1.00
R4629:Angpt1 UTSW 15 42,301,796 (GRCm39) missense probably benign 0.01
R4647:Angpt1 UTSW 15 42,539,580 (GRCm39) missense probably benign 0.02
R4648:Angpt1 UTSW 15 42,539,580 (GRCm39) missense probably benign 0.02
R4750:Angpt1 UTSW 15 42,539,797 (GRCm39) missense probably benign 0.00
R5222:Angpt1 UTSW 15 42,539,730 (GRCm39) missense probably damaging 1.00
R5386:Angpt1 UTSW 15 42,301,761 (GRCm39) missense probably damaging 1.00
R5457:Angpt1 UTSW 15 42,386,916 (GRCm39) missense probably damaging 1.00
R5526:Angpt1 UTSW 15 42,375,737 (GRCm39) missense probably damaging 1.00
R6154:Angpt1 UTSW 15 42,387,051 (GRCm39) missense probably damaging 1.00
R6904:Angpt1 UTSW 15 42,323,136 (GRCm39) missense probably benign 0.00
R7009:Angpt1 UTSW 15 42,386,991 (GRCm39) missense possibly damaging 0.83
R7101:Angpt1 UTSW 15 42,386,965 (GRCm39) missense probably benign 0.18
R7139:Angpt1 UTSW 15 42,539,747 (GRCm39) missense probably damaging 1.00
R7234:Angpt1 UTSW 15 42,323,121 (GRCm39) missense probably benign 0.25
R7830:Angpt1 UTSW 15 42,539,664 (GRCm39) missense probably damaging 1.00
R8046:Angpt1 UTSW 15 42,359,752 (GRCm39) missense probably benign 0.00
R8073:Angpt1 UTSW 15 42,301,699 (GRCm39) missense probably benign 0.00
R8093:Angpt1 UTSW 15 42,339,873 (GRCm39) missense probably benign 0.01
R8331:Angpt1 UTSW 15 42,539,653 (GRCm39) missense probably damaging 1.00
R8391:Angpt1 UTSW 15 42,375,794 (GRCm39) missense probably damaging 1.00
R8411:Angpt1 UTSW 15 42,290,430 (GRCm39) missense probably damaging 1.00
R8787:Angpt1 UTSW 15 42,375,780 (GRCm39) missense probably damaging 1.00
R9297:Angpt1 UTSW 15 42,301,751 (GRCm39) missense probably benign
R9318:Angpt1 UTSW 15 42,301,751 (GRCm39) missense probably benign
R9746:Angpt1 UTSW 15 42,539,837 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CACATTGGCTGTACCTGCATC -3'
(R):5'- AAACTTAGTTCCCATCTGCCTG -3'

Sequencing Primer
(F):5'- AAGAAACTTTCAGTTGCCGGTG -3'
(R):5'- GCCTGTGTTTCCACTTACAAAG -3'
Posted On 2020-10-20