Incidental Mutation 'R8508:Atp6v1a'
ID655726
Institutional Source Beutler Lab
Gene Symbol Atp6v1a
Ensembl Gene ENSMUSG00000052459
Gene NameATPase, H+ transporting, lysosomal V1 subunit A
SynonymsAtp6a1, VA68, VPP2, lysosomal 70kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R8508 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location44085402-44139705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44101862 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 338 (R338C)
Ref Sequence ENSEMBL: ENSMUSP00000066886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063661] [ENSMUST00000114666]
Predicted Effect probably damaging
Transcript: ENSMUST00000063661
AA Change: R338C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066886
Gene: ENSMUSG00000052459
AA Change: R338C

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 21 83 8.5e-16 PFAM
low complexity region 206 217 N/A INTRINSIC
Pfam:ATP-synt_ab 229 455 4.4e-113 PFAM
Pfam:ATP-synt_ab_C 473 617 2.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114666
AA Change: R338C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110314
Gene: ENSMUSG00000052459
AA Change: R338C

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 21 83 2.4e-16 PFAM
Pfam:ATP-synt_ab_Xtn 99 221 3.3e-46 PFAM
Pfam:ATP-synt_ab 230 455 3.3e-110 PFAM
Pfam:ATP-synt_ab_C 473 617 2.4e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of two V1 domain A subunit isoforms and is found in all tissues. Transcript variants derived from alternative polyadenylation exist. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,598 L136P probably benign Het
4932438H23Rik T G 16: 91,055,612 Y212S probably damaging Het
Angpt1 T C 15: 42,512,399 N154D probably damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Ankrd27 T A 7: 35,601,626 L117* probably null Het
Arhgap21 C T 2: 20,854,180 M1234I probably benign Het
Arhgef33 A G 17: 80,367,335 E387G probably damaging Het
Atp13a4 T A 16: 29,454,769 K444* probably null Het
Canx T C 11: 50,311,647 D44G possibly damaging Het
Ccdc141 T A 2: 77,132,244 M119L probably benign Het
Ckmt1 A C 2: 121,362,691 Q299P possibly damaging Het
Dhx16 T C 17: 35,885,920 S601P probably damaging Het
Dna2 A C 10: 62,950,894 R140S probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Eogt A G 6: 97,143,998 S85P possibly damaging Het
Fbf1 A T 11: 116,165,881 M1K probably null Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flnb G A 14: 7,950,394 V2571I probably damaging Het
Gm11361 A G 13: 28,257,711 I26V probably benign Het
Gm43518 A G 5: 123,938,259 E123G unknown Het
Gm8332 T G 12: 88,249,685 E139A unknown Het
Gpatch2 A G 1: 187,304,355 N374S probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Hoxa11 T C 6: 52,245,802 probably benign Het
Hydin G A 8: 110,582,018 V3979I probably benign Het
Ighe C T 12: 113,271,793 W277* probably null Het
Kmt2c G T 5: 25,314,122 T2330K probably benign Het
Krt6a T A 15: 101,692,735 K261M probably damaging Het
Lats2 A C 14: 57,722,705 S161A probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Npepps A G 11: 97,244,426 probably null Het
Ntn4 A T 10: 93,741,104 N545Y possibly damaging Het
Olfr1501 A T 19: 13,838,402 M257K possibly damaging Het
Olfr164 T C 16: 19,286,701 D14G probably benign Het
Olfr353 A G 2: 36,890,354 S165P probably damaging Het
Olfr738 A C 14: 50,413,675 M44L probably benign Het
Osbpl2 T A 2: 180,155,343 V358E possibly damaging Het
Pdcd11 C A 19: 47,119,806 P1204Q probably damaging Het
Pnliprp2 A C 19: 58,763,374 S184R probably damaging Het
Ppm1g G T 5: 31,204,528 R373S probably damaging Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Setd5 T C 6: 113,121,087 S696P probably damaging Het
Sgip1 A G 4: 102,915,071 Q219R probably benign Het
Slc1a2 T C 2: 102,736,085 probably null Het
Slc22a12 T C 19: 6,542,437 T106A probably benign Het
Slc22a14 A G 9: 119,180,585 L148P probably damaging Het
Slc2a9 A T 5: 38,382,078 F375I probably damaging Het
Sorbs3 A T 14: 70,202,947 D117E probably benign Het
Sphkap G A 1: 83,276,500 T1176I probably damaging Het
Supt16 A T 14: 52,181,589 V193D probably damaging Het
Sytl3 A G 17: 6,728,291 T362A probably damaging Het
Tctn1 T A 5: 122,246,611 Q410L probably benign Het
Trbc2 T C 6: 41,547,777 Y133H Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r120 A G 17: 57,525,843 V112A probably benign Het
Zfp354b A T 11: 50,923,470 S209R probably benign Het
Zfp362 T C 4: 128,774,606 H391R probably damaging Het
Other mutations in Atp6v1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Atp6v1a APN 16 44111583 missense probably benign 0.00
IGL01860:Atp6v1a APN 16 44099956 missense probably damaging 1.00
IGL02691:Atp6v1a APN 16 44111619 missense probably damaging 1.00
IGL03256:Atp6v1a APN 16 44111088 unclassified probably benign
IGL03307:Atp6v1a APN 16 44111559 missense possibly damaging 0.74
R0605:Atp6v1a UTSW 16 44111496 critical splice donor site probably null
R0696:Atp6v1a UTSW 16 44087471 missense probably benign
R0883:Atp6v1a UTSW 16 44101692 splice site probably benign
R1777:Atp6v1a UTSW 16 44114705 nonsense probably null
R2370:Atp6v1a UTSW 16 44107040 missense probably benign 0.10
R2932:Atp6v1a UTSW 16 44089043 missense probably benign 0.03
R3725:Atp6v1a UTSW 16 44101757 splice site probably benign
R4224:Atp6v1a UTSW 16 44101811 missense probably damaging 1.00
R5780:Atp6v1a UTSW 16 44114643 missense probably benign 0.01
R5945:Atp6v1a UTSW 16 44099946 missense probably damaging 0.99
R6032:Atp6v1a UTSW 16 44106940 missense probably damaging 1.00
R6032:Atp6v1a UTSW 16 44106940 missense probably damaging 1.00
R6036:Atp6v1a UTSW 16 44098831 missense probably benign 0.02
R6036:Atp6v1a UTSW 16 44098831 missense probably benign 0.02
R6387:Atp6v1a UTSW 16 44087443 missense possibly damaging 0.76
R6479:Atp6v1a UTSW 16 44098758 missense probably benign 0.00
R6756:Atp6v1a UTSW 16 44089058 missense probably benign 0.18
R7313:Atp6v1a UTSW 16 44114617 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCAAGGTATGCAGGGTATCC -3'
(R):5'- CAAAAGTGGCTCTTTGGTCTTC -3'

Sequencing Primer
(F):5'- CAAGGTATGCAGGGTATCCACTATC -3'
(R):5'- TAACATGTCTGGCCATGGAAC -3'
Posted On2020-10-20