Incidental Mutation 'R8508:Arhgef33'
ID655731
Institutional Source Beutler Lab
Gene Symbol Arhgef33
Ensembl Gene ENSMUSG00000054901
Gene NameRho guanine nucleotide exchange factor (GEF) 33
SynonymsLOC381112, Gm941
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8508 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location80307407-80400081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80367335 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 387 (E387G)
Ref Sequence ENSEMBL: ENSMUSP00000063284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068175] [ENSMUST00000223878]
Predicted Effect probably damaging
Transcript: ENSMUST00000068175
AA Change: E387G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063284
Gene: ENSMUSG00000054901
AA Change: E387G

DomainStartEndE-ValueType
coiled coil region 64 128 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
Pfam:RhoGEF 277 446 4.7e-16 PFAM
low complexity region 455 473 N/A INTRINSIC
low complexity region 510 520 N/A INTRINSIC
low complexity region 620 629 N/A INTRINSIC
low complexity region 751 770 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223878
AA Change: E387G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,598 L136P probably benign Het
4932438H23Rik T G 16: 91,055,612 Y212S probably damaging Het
Angpt1 T C 15: 42,512,399 N154D probably damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Ankrd27 T A 7: 35,601,626 L117* probably null Het
Arhgap21 C T 2: 20,854,180 M1234I probably benign Het
Atp13a4 T A 16: 29,454,769 K444* probably null Het
Atp6v1a G A 16: 44,101,862 R338C probably damaging Het
Canx T C 11: 50,311,647 D44G possibly damaging Het
Ccdc141 T A 2: 77,132,244 M119L probably benign Het
Ckmt1 A C 2: 121,362,691 Q299P possibly damaging Het
Dhx16 T C 17: 35,885,920 S601P probably damaging Het
Dna2 A C 10: 62,950,894 R140S probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Eogt A G 6: 97,143,998 S85P possibly damaging Het
Fbf1 A T 11: 116,165,881 M1K probably null Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flnb G A 14: 7,950,394 V2571I probably damaging Het
Gm11361 A G 13: 28,257,711 I26V probably benign Het
Gm43518 A G 5: 123,938,259 E123G unknown Het
Gm8332 T G 12: 88,249,685 E139A unknown Het
Gpatch2 A G 1: 187,304,355 N374S probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Hoxa11 T C 6: 52,245,802 probably benign Het
Hydin G A 8: 110,582,018 V3979I probably benign Het
Ighe C T 12: 113,271,793 W277* probably null Het
Kmt2c G T 5: 25,314,122 T2330K probably benign Het
Krt6a T A 15: 101,692,735 K261M probably damaging Het
Lats2 A C 14: 57,722,705 S161A probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Npepps A G 11: 97,244,426 probably null Het
Ntn4 A T 10: 93,741,104 N545Y possibly damaging Het
Olfr1501 A T 19: 13,838,402 M257K possibly damaging Het
Olfr164 T C 16: 19,286,701 D14G probably benign Het
Olfr353 A G 2: 36,890,354 S165P probably damaging Het
Olfr738 A C 14: 50,413,675 M44L probably benign Het
Osbpl2 T A 2: 180,155,343 V358E possibly damaging Het
Pdcd11 C A 19: 47,119,806 P1204Q probably damaging Het
Pnliprp2 A C 19: 58,763,374 S184R probably damaging Het
Ppm1g G T 5: 31,204,528 R373S probably damaging Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Setd5 T C 6: 113,121,087 S696P probably damaging Het
Sgip1 A G 4: 102,915,071 Q219R probably benign Het
Slc1a2 T C 2: 102,736,085 probably null Het
Slc22a12 T C 19: 6,542,437 T106A probably benign Het
Slc22a14 A G 9: 119,180,585 L148P probably damaging Het
Slc2a9 A T 5: 38,382,078 F375I probably damaging Het
Sorbs3 A T 14: 70,202,947 D117E probably benign Het
Sphkap G A 1: 83,276,500 T1176I probably damaging Het
Supt16 A T 14: 52,181,589 V193D probably damaging Het
Sytl3 A G 17: 6,728,291 T362A probably damaging Het
Tctn1 T A 5: 122,246,611 Q410L probably benign Het
Trbc2 T C 6: 41,547,777 Y133H Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r120 A G 17: 57,525,843 V112A probably benign Het
Zfp354b A T 11: 50,923,470 S209R probably benign Het
Zfp362 T C 4: 128,774,606 H391R probably damaging Het
Other mutations in Arhgef33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Arhgef33 APN 17 80368230 missense probably benign 0.33
IGL00784:Arhgef33 APN 17 80368230 missense probably benign 0.33
IGL01601:Arhgef33 APN 17 80347683 missense probably damaging 1.00
IGL01647:Arhgef33 APN 17 80365266 splice site probably benign
IGL02654:Arhgef33 APN 17 80370311 missense probably damaging 1.00
IGL02712:Arhgef33 APN 17 80360373 missense probably damaging 1.00
R0195:Arhgef33 UTSW 17 80381434 missense probably damaging 0.96
R0732:Arhgef33 UTSW 17 80381354 missense possibly damaging 0.90
R0834:Arhgef33 UTSW 17 80347597 splice site probably benign
R1144:Arhgef33 UTSW 17 80355044 missense probably benign
R1465:Arhgef33 UTSW 17 80367301 missense possibly damaging 0.88
R1465:Arhgef33 UTSW 17 80367301 missense possibly damaging 0.88
R1513:Arhgef33 UTSW 17 80371389 missense probably benign
R1680:Arhgef33 UTSW 17 80347651 missense probably damaging 0.96
R1696:Arhgef33 UTSW 17 80349506 missense probably damaging 1.00
R1775:Arhgef33 UTSW 17 80373743 missense probably benign 0.05
R2046:Arhgef33 UTSW 17 80373466 missense probably benign 0.08
R3933:Arhgef33 UTSW 17 80373320 missense probably benign 0.01
R4573:Arhgef33 UTSW 17 80365282 missense probably damaging 1.00
R5222:Arhgef33 UTSW 17 80337314 missense probably damaging 1.00
R5269:Arhgef33 UTSW 17 80370275 missense probably damaging 1.00
R5933:Arhgef33 UTSW 17 80337280 missense probably benign
R6460:Arhgef33 UTSW 17 80349589 splice site probably null
R7307:Arhgef33 UTSW 17 80347120 critical splice acceptor site probably null
R7594:Arhgef33 UTSW 17 80370305 missense probably damaging 1.00
R7746:Arhgef33 UTSW 17 80347120 critical splice acceptor site probably null
R7895:Arhgef33 UTSW 17 80373485 missense probably benign 0.00
R7956:Arhgef33 UTSW 17 80355048 missense possibly damaging 0.81
Z1177:Arhgef33 UTSW 17 80384230 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTAAATTTGGAAGAAACAACAAAGG -3'
(R):5'- CGGATCCCTGAATGAACTCCTTC -3'

Sequencing Primer
(F):5'- TTGACCTTTGAGGACACCAG -3'
(R):5'- TGAATGAACTCCTTCAGCCTAG -3'
Posted On2020-10-20