Incidental Mutation 'R8508:Pnliprp2'
ID655735
Institutional Source Beutler Lab
Gene Symbol Pnliprp2
Ensembl Gene ENSMUSG00000025091
Gene Namepancreatic lipase-related protein 2
SynonymsPLRP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R8508 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location58759723-58777533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 58763374 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 184 (S184R)
Ref Sequence ENSEMBL: ENSMUSP00000026081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026081]
Predicted Effect probably damaging
Transcript: ENSMUST00000026081
AA Change: S184R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026081
Gene: ENSMUSG00000025091
AA Change: S184R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Lipase 31 367 4.1e-166 PFAM
LH2 370 482 7.49e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lipase that hydrolyzes galactolipids, the main components of plant membrane lipids. An allelic polymorphism in this gene results in both coding and non-coding variants; the reference genome represents the non-coding allele. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display deficient lipid absorbtion before weaning which results in growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A G 13: 59,743,598 L136P probably benign Het
4932438H23Rik T G 16: 91,055,612 Y212S probably damaging Het
Angpt1 T C 15: 42,512,399 N154D probably damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Ankrd27 T A 7: 35,601,626 L117* probably null Het
Arhgap21 C T 2: 20,854,180 M1234I probably benign Het
Arhgef33 A G 17: 80,367,335 E387G probably damaging Het
Atp13a4 T A 16: 29,454,769 K444* probably null Het
Atp6v1a G A 16: 44,101,862 R338C probably damaging Het
Canx T C 11: 50,311,647 D44G possibly damaging Het
Ccdc141 T A 2: 77,132,244 M119L probably benign Het
Ckmt1 A C 2: 121,362,691 Q299P possibly damaging Het
Dhx16 T C 17: 35,885,920 S601P probably damaging Het
Dna2 A C 10: 62,950,894 R140S probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Eogt A G 6: 97,143,998 S85P possibly damaging Het
Fbf1 A T 11: 116,165,881 M1K probably null Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Flnb G A 14: 7,950,394 V2571I probably damaging Het
Gm11361 A G 13: 28,257,711 I26V probably benign Het
Gm43518 A G 5: 123,938,259 E123G unknown Het
Gm8332 T G 12: 88,249,685 E139A unknown Het
Gpatch2 A G 1: 187,304,355 N374S probably benign Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Hoxa11 T C 6: 52,245,802 probably benign Het
Hydin G A 8: 110,582,018 V3979I probably benign Het
Ighe C T 12: 113,271,793 W277* probably null Het
Kmt2c G T 5: 25,314,122 T2330K probably benign Het
Krt6a T A 15: 101,692,735 K261M probably damaging Het
Lats2 A C 14: 57,722,705 S161A probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Mipol1 T C 12: 57,306,088 V71A possibly damaging Het
Mphosph8 A T 14: 56,676,546 K415* probably null Het
Npepps A G 11: 97,244,426 probably null Het
Ntn4 A T 10: 93,741,104 N545Y possibly damaging Het
Olfr1501 A T 19: 13,838,402 M257K possibly damaging Het
Olfr164 T C 16: 19,286,701 D14G probably benign Het
Olfr353 A G 2: 36,890,354 S165P probably damaging Het
Olfr738 A C 14: 50,413,675 M44L probably benign Het
Osbpl2 T A 2: 180,155,343 V358E possibly damaging Het
Pdcd11 C A 19: 47,119,806 P1204Q probably damaging Het
Ppm1g G T 5: 31,204,528 R373S probably damaging Het
Rnf130 A G 11: 50,087,437 D275G probably damaging Het
Setd5 T C 6: 113,121,087 S696P probably damaging Het
Sgip1 A G 4: 102,915,071 Q219R probably benign Het
Slc1a2 T C 2: 102,736,085 probably null Het
Slc22a12 T C 19: 6,542,437 T106A probably benign Het
Slc22a14 A G 9: 119,180,585 L148P probably damaging Het
Slc2a9 A T 5: 38,382,078 F375I probably damaging Het
Sorbs3 A T 14: 70,202,947 D117E probably benign Het
Sphkap G A 1: 83,276,500 T1176I probably damaging Het
Supt16 A T 14: 52,181,589 V193D probably damaging Het
Sytl3 A G 17: 6,728,291 T362A probably damaging Het
Tctn1 T A 5: 122,246,611 Q410L probably benign Het
Trbc2 T C 6: 41,547,777 Y133H Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r120 A G 17: 57,525,843 V112A probably benign Het
Zfp354b A T 11: 50,923,470 S209R probably benign Het
Zfp362 T C 4: 128,774,606 H391R probably damaging Het
Other mutations in Pnliprp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Pnliprp2 APN 19 58760497 missense probably benign
IGL02739:Pnliprp2 APN 19 58760509 critical splice donor site probably null
IGL02881:Pnliprp2 APN 19 58771446 missense probably benign 0.01
IGL03411:Pnliprp2 APN 19 58760415 missense probably benign
R0140:Pnliprp2 UTSW 19 58766363 missense probably benign 0.00
R0558:Pnliprp2 UTSW 19 58774087 missense probably benign 0.00
R1873:Pnliprp2 UTSW 19 58763389 missense probably benign 0.00
R1874:Pnliprp2 UTSW 19 58763389 missense probably benign 0.00
R1875:Pnliprp2 UTSW 19 58763389 missense probably benign 0.00
R2382:Pnliprp2 UTSW 19 58768630 missense probably benign 0.00
R3893:Pnliprp2 UTSW 19 58766273 missense probably benign 0.19
R3915:Pnliprp2 UTSW 19 58760362 missense probably damaging 1.00
R4620:Pnliprp2 UTSW 19 58762286 missense possibly damaging 0.67
R4893:Pnliprp2 UTSW 19 58771421 missense probably benign 0.08
R4957:Pnliprp2 UTSW 19 58775145 missense possibly damaging 0.72
R4959:Pnliprp2 UTSW 19 58766318 missense probably benign 0.16
R4973:Pnliprp2 UTSW 19 58766318 missense probably benign 0.16
R5346:Pnliprp2 UTSW 19 58759800 missense probably benign
R6049:Pnliprp2 UTSW 19 58760452 missense possibly damaging 0.77
R6228:Pnliprp2 UTSW 19 58763442 critical splice donor site probably null
R6394:Pnliprp2 UTSW 19 58761598 missense probably benign
R6829:Pnliprp2 UTSW 19 58759873 missense probably benign
R7235:Pnliprp2 UTSW 19 58775227 missense probably benign 0.03
R7534:Pnliprp2 UTSW 19 58775142 missense probably benign
R7834:Pnliprp2 UTSW 19 58774159 missense probably benign 0.25
R8015:Pnliprp2 UTSW 19 58766282 missense probably damaging 0.99
X0058:Pnliprp2 UTSW 19 58774142 missense possibly damaging 0.59
Z1088:Pnliprp2 UTSW 19 58762325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAATCTTTTCCCCTGGAGTC -3'
(R):5'- TGACTATGGATTTTCTAGCAGGC -3'

Sequencing Primer
(F):5'- GGAGTCTCCAGCTCCATCC -3'
(R):5'- TCAGGACATCACCTAATATAAGGAG -3'
Posted On2020-10-20