Incidental Mutation 'R8509:1110004F10Rik'
ID 655759
Institutional Source Beutler Lab
Gene Symbol 1110004F10Rik
Ensembl Gene ENSMUSG00000030663
Gene Name RIKEN cDNA 1110004F10 gene
Synonyms sid2057
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock # R8509 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 116039397-116105210 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 116104434 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 181 (S181P)
Ref Sequence ENSEMBL: ENSMUSP00000032899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032899] [ENSMUST00000106607] [ENSMUST00000106608] [ENSMUST00000151254] [ENSMUST00000205427] [ENSMUST00000205450]
AlphaFold Q9R0P4
Predicted Effect possibly damaging
Transcript: ENSMUST00000032899
AA Change: S181P

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032899
Gene: ENSMUSG00000030663
AA Change: S181P

DomainStartEndE-ValueType
Pfam:SMAP 27 103 1.1e-17 PFAM
low complexity region 105 155 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106607
AA Change: S94P

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102218
Gene: ENSMUSG00000030663
AA Change: S94P

DomainStartEndE-ValueType
low complexity region 18 68 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106608
AA Change: S137P

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102219
Gene: ENSMUSG00000030663
AA Change: S137P

DomainStartEndE-ValueType
Pfam:SMAP 1 59 7.8e-10 PFAM
low complexity region 61 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151254
SMART Domains Protein: ENSMUSP00000116035
Gene: ENSMUSG00000030663

DomainStartEndE-ValueType
Pfam:SMAP 26 79 4.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205427
Predicted Effect probably benign
Transcript: ENSMUST00000205450
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,291,116 V2020A probably benign Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Ano3 T C 2: 110,665,835 E858G possibly damaging Het
Asrgl1 T C 19: 9,114,226 K244E probably damaging Het
BC048679 T A 7: 81,495,368 T82S probably benign Het
Brip1 A T 11: 86,197,948 C42* probably null Het
Cabcoco1 T C 10: 68,431,289 E296G probably damaging Het
Ccnb1ip1 T C 14: 50,792,257 N116S probably benign Het
Cep95 A G 11: 106,805,050 E214G probably benign Het
Cyp11b1 A G 15: 74,839,353 F159L possibly damaging Het
Dmxl2 C A 9: 54,428,057 E660* probably null Het
Dnah14 C T 1: 181,814,655 T112M Het
Fancd2 A G 6: 113,572,570 T74A probably benign Het
Fat4 G T 3: 38,981,903 V3235L probably benign Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,667,034 probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gmcl1 A C 6: 86,722,607 I146S probably damaging Het
Hbb-bs T A 7: 103,826,712 K133* probably null Het
Hey1 G C 3: 8,664,776 A207G probably benign Het
Hmcn1 T A 1: 150,573,551 K5446* probably null Het
Hyal6 A T 6: 24,734,606 E179D probably damaging Het
Inpp5b T A 4: 124,743,905 probably null Het
Lrba A G 3: 86,348,176 K942E probably benign Het
Lrrcc1 A G 3: 14,536,507 N110S probably damaging Het
Mcoln3 A G 3: 146,124,892 I126V probably benign Het
Ncoa7 T C 10: 30,696,052 I242V probably benign Het
Ndufb4 A G 16: 37,649,144 I66T probably benign Het
Npffr2 T C 5: 89,583,329 S373P possibly damaging Het
Olfr1165-ps T C 2: 88,101,522 Y155C probably benign Het
Pi4ka A T 16: 17,354,144 I579N Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ripk2 T C 4: 16,124,436 E424G probably benign Het
Rnf19b T A 4: 129,073,576 C304S probably damaging Het
Rtp1 T C 16: 23,429,314 W46R probably damaging Het
Ryr2 A G 13: 11,577,778 probably null Het
Sbf1 A T 15: 89,293,457 D1674E probably damaging Het
Sgf29 T A 7: 126,671,662 probably benign Het
Slc22a8 T C 19: 8,607,975 probably null Het
Smg6 T C 11: 75,041,876 S998P probably benign Het
Srgap3 G A 6: 112,731,336 Q801* probably null Het
Taf4b A G 18: 14,898,055 D832G probably damaging Het
Trim12a T C 7: 104,306,027 D163G probably benign Het
Trim46 A G 3: 89,245,713 probably null Het
Trpm4 A G 7: 45,322,361 V274A probably damaging Het
Unc80 A G 1: 66,641,629 D2128G possibly damaging Het
Other mutations in 1110004F10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2391:1110004F10Rik UTSW 7 116104226 missense probably damaging 0.99
R4789:1110004F10Rik UTSW 7 116093522 missense probably benign 0.03
R6249:1110004F10Rik UTSW 7 116103270 missense probably damaging 1.00
R6802:1110004F10Rik UTSW 7 116099490 missense probably damaging 1.00
R7960:1110004F10Rik UTSW 7 116103246 missense possibly damaging 0.83
R9063:1110004F10Rik UTSW 7 116104425 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCTCATAGGCCTTTGGTTG -3'
(R):5'- CTGGAGAAATGTAACCCATGGC -3'

Sequencing Primer
(F):5'- ATGACGATGAGGACGACTCCC -3'
(R):5'- GTAACCCATGGCATTTGAAAGC -3'
Posted On 2020-10-20